FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628057_at:

>probe:Drosophila_2:1628057_at:728:75; Interrogation_Position=1448; Antisense; AGGAGAGTTGGCGTCATCCCCAGGA
>probe:Drosophila_2:1628057_at:327:397; Interrogation_Position=1471; Antisense; GACAATAACTTCTGCAATCCCTCGA
>probe:Drosophila_2:1628057_at:46:637; Interrogation_Position=1492; Antisense; TCGAAGCCAGTCAGCCTAGAGTCTT
>probe:Drosophila_2:1628057_at:53:607; Interrogation_Position=1526; Antisense; TGATGGCTGCCATATATGCTGCTCA
>probe:Drosophila_2:1628057_at:596:511; Interrogation_Position=1582; Antisense; GTGACCGCGCTCGAGATGTCGGAAA
>probe:Drosophila_2:1628057_at:580:181; Interrogation_Position=1605; Antisense; AAAACTGCTGGCCTGTGAACGCTTG
>probe:Drosophila_2:1628057_at:669:381; Interrogation_Position=1621; Antisense; GAACGCTTGTCCGATGCACACAAAT
>probe:Drosophila_2:1628057_at:65:725; Interrogation_Position=1645; Antisense; TTGCTAGGTCACATGTACGCTGGCG
>probe:Drosophila_2:1628057_at:611:555; Interrogation_Position=1716; Antisense; GGACCCTACTTTTGTGGGCACACTA
>probe:Drosophila_2:1628057_at:250:725; Interrogation_Position=1754; Antisense; TTGAGACGCGTGACTGGCAACTGAA
>probe:Drosophila_2:1628057_at:701:621; Interrogation_Position=1805; Antisense; TGCGGTATAATCTGGCCGTTGCCAT
>probe:Drosophila_2:1628057_at:468:663; Interrogation_Position=1857; Antisense; TAAAGCACTCCTGGCCAATTTAACT
>probe:Drosophila_2:1628057_at:622:709; Interrogation_Position=1876; Antisense; TTAACTCATTCGCTGGTTGCCAACA
>probe:Drosophila_2:1628057_at:289:723; Interrogation_Position=1912; Antisense; TTGCGACGCTTCATGGACCTCAAAA

Paste this into a BLAST search page for me
AGGAGAGTTGGCGTCATCCCCAGGAGACAATAACTTCTGCAATCCCTCGATCGAAGCCAGTCAGCCTAGAGTCTTTGATGGCTGCCATATATGCTGCTCAGTGACCGCGCTCGAGATGTCGGAAAAAAACTGCTGGCCTGTGAACGCTTGGAACGCTTGTCCGATGCACACAAATTTGCTAGGTCACATGTACGCTGGCGGGACCCTACTTTTGTGGGCACACTATTGAGACGCGTGACTGGCAACTGAATGCGGTATAATCTGGCCGTTGCCATTAAAGCACTCCTGGCCAATTTAACTTTAACTCATTCGCTGGTTGCCAACATTGCGACGCTTCATGGACCTCAAAA

Full Affymetrix probeset data:

Annotations for 1628057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720