FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628061_at:

>probe:Drosophila_2:1628061_at:688:327; Interrogation_Position=280; Antisense; GCGTTCCTACAACTGGTCCGTGAAG
>probe:Drosophila_2:1628061_at:223:213; Interrogation_Position=308; Antisense; AAGAGGAGGAAGACCACCGGCACCG
>probe:Drosophila_2:1628061_at:81:503; Interrogation_Position=333; Antisense; GTCGCATGCAGCACCTGAAGGTTGT
>probe:Drosophila_2:1628061_at:532:195; Interrogation_Position=374; Antisense; AACGGATTCCGCGAGGGCACCCAGG
>probe:Drosophila_2:1628061_at:571:217; Interrogation_Position=425; Antisense; AAGTAGGAGGCTCTGTGTGTCCCAA
>probe:Drosophila_2:1628061_at:310:483; Interrogation_Position=453; Antisense; GTATATCCCACACCGGGCTATATGG
>probe:Drosophila_2:1628061_at:451:141; Interrogation_Position=478; Antisense; ACGGAGATAGCAGCTGCTCCCTTAA
>probe:Drosophila_2:1628061_at:298:709; Interrogation_Position=499; Antisense; TTAACCGCAGATAACGACAGCCTCC
>probe:Drosophila_2:1628061_at:555:399; Interrogation_Position=514; Antisense; GACAGCCTCCAGTTGATCAACGTGT
>probe:Drosophila_2:1628061_at:432:169; Interrogation_Position=562; Antisense; AAATGGCCCCTCAACATGGCTAATA
>probe:Drosophila_2:1628061_at:550:255; Interrogation_Position=727; Antisense; CAAATGCTTGTAGGGCTGATTTCCT
>probe:Drosophila_2:1628061_at:508:161; Interrogation_Position=766; Antisense; AAATTGTTAGTGTTCGCTGGTAGTC
>probe:Drosophila_2:1628061_at:527:363; Interrogation_Position=791; Antisense; GAATACTTTTCCAGGGCAGGCTATC
>probe:Drosophila_2:1628061_at:329:567; Interrogation_Position=805; Antisense; GGCAGGCTATCCACGTAGCTTTTAT

Paste this into a BLAST search page for me
GCGTTCCTACAACTGGTCCGTGAAGAAGAGGAGGAAGACCACCGGCACCGGTCGCATGCAGCACCTGAAGGTTGTAACGGATTCCGCGAGGGCACCCAGGAAGTAGGAGGCTCTGTGTGTCCCAAGTATATCCCACACCGGGCTATATGGACGGAGATAGCAGCTGCTCCCTTAATTAACCGCAGATAACGACAGCCTCCGACAGCCTCCAGTTGATCAACGTGTAAATGGCCCCTCAACATGGCTAATACAAATGCTTGTAGGGCTGATTTCCTAAATTGTTAGTGTTCGCTGGTAGTCGAATACTTTTCCAGGGCAGGCTATCGGCAGGCTATCCACGTAGCTTTTAT

Full Affymetrix probeset data:

Annotations for 1628061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720