FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628063_at:

>probe:Drosophila_2:1628063_at:442:469; Interrogation_Position=2191; Antisense; GTTCGCCTGAATGTCGTGGTGCCAA
>probe:Drosophila_2:1628063_at:624:79; Interrogation_Position=2232; Antisense; AGGTCCTGACCTTCACGTGGATAAA
>probe:Drosophila_2:1628063_at:140:151; Interrogation_Position=2275; Antisense; ACTTGCACTGTAAAGTTCAGCCCCG
>probe:Drosophila_2:1628063_at:435:317; Interrogation_Position=2304; Antisense; GCCGGCCTACATCTTTTGGTATCAT
>probe:Drosophila_2:1628063_at:155:59; Interrogation_Position=2348; Antisense; ATGATTCATCAAGAGGCGGCGTGTC
>probe:Drosophila_2:1628063_at:335:63; Interrogation_Position=2393; Antisense; ATGTGACAACCTCATTTCTGCTCAT
>probe:Drosophila_2:1628063_at:93:369; Interrogation_Position=2421; Antisense; GAATGCAGATCTGGCCGATTCGGGC
>probe:Drosophila_2:1628063_at:355:463; Interrogation_Position=2437; Antisense; GATTCGGGCAAATACTCCTGTGCGC
>probe:Drosophila_2:1628063_at:511:267; Interrogation_Position=2481; Antisense; CAGTGTGCGTGTGCATGTCCTAAAT
>probe:Drosophila_2:1628063_at:358:423; Interrogation_Position=2537; Antisense; GAGATCCGCCTTCCGAAAATCGGGA
>probe:Drosophila_2:1628063_at:601:105; Interrogation_Position=2578; Antisense; AGAAATTGTTGCCATCCTCTGGGCA
>probe:Drosophila_2:1628063_at:172:369; Interrogation_Position=2610; Antisense; GAATGCCACGCCCATGAAATGCCAT
>probe:Drosophila_2:1628063_at:264:143; Interrogation_Position=2684; Antisense; ACTGTGCTGCCATTTTGTTTTCTTT
>probe:Drosophila_2:1628063_at:90:691; Interrogation_Position=2706; Antisense; TTTGTTGCGTTTCAAGCTCCGATGC

Paste this into a BLAST search page for me
GTTCGCCTGAATGTCGTGGTGCCAAAGGTCCTGACCTTCACGTGGATAAAACTTGCACTGTAAAGTTCAGCCCCGGCCGGCCTACATCTTTTGGTATCATATGATTCATCAAGAGGCGGCGTGTCATGTGACAACCTCATTTCTGCTCATGAATGCAGATCTGGCCGATTCGGGCGATTCGGGCAAATACTCCTGTGCGCCAGTGTGCGTGTGCATGTCCTAAATGAGATCCGCCTTCCGAAAATCGGGAAGAAATTGTTGCCATCCTCTGGGCAGAATGCCACGCCCATGAAATGCCATACTGTGCTGCCATTTTGTTTTCTTTTTTGTTGCGTTTCAAGCTCCGATGC

Full Affymetrix probeset data:

Annotations for 1628063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720