FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628065_at:

>probe:Drosophila_2:1628065_at:221:189; Interrogation_Position=1006; Antisense; AACAGGAGGCGCTCTCTGAGGTCGC
>probe:Drosophila_2:1628065_at:528:543; Interrogation_Position=1040; Antisense; GGATCTCGCGGGAAACTCCAGGTCT
>probe:Drosophila_2:1628065_at:625:379; Interrogation_Position=1074; Antisense; GAAGCCTCAGGCAGTGGTCAGCAGA
>probe:Drosophila_2:1628065_at:571:261; Interrogation_Position=1095; Antisense; CAGAATGCGACAGTGGCTTCTACCA
>probe:Drosophila_2:1628065_at:613:363; Interrogation_Position=1144; Antisense; GAATCGGTTCCAAACCGTGCTCAAT
>probe:Drosophila_2:1628065_at:474:633; Interrogation_Position=695; Antisense; TCCGCCATGCAGGATCACCATTAAA
>probe:Drosophila_2:1628065_at:464:183; Interrogation_Position=719; Antisense; AAAAGTTCCAGTGCACAGTACTCCA
>probe:Drosophila_2:1628065_at:497:529; Interrogation_Position=750; Antisense; GGGATGTGCCAAGCTCAGGAGATCA
>probe:Drosophila_2:1628065_at:589:427; Interrogation_Position=768; Antisense; GAGATCAATTCCAAGGCCACCATAA
>probe:Drosophila_2:1628065_at:640:193; Interrogation_Position=844; Antisense; AACTGCAACCATTGTCACCTATAAC
>probe:Drosophila_2:1628065_at:677:403; Interrogation_Position=879; Antisense; GACTCATTGGAGCTGTTCTTCGACA
>probe:Drosophila_2:1628065_at:274:23; Interrogation_Position=906; Antisense; ATATGTGCCACCGTCAAGAACTTGC
>probe:Drosophila_2:1628065_at:111:659; Interrogation_Position=953; Antisense; TAAGATCCGGGTAATGCAGCTCATT
>probe:Drosophila_2:1628065_at:663:93; Interrogation_Position=988; Antisense; AGTTGCGTGCTCTTTGCGAACAGGA

Paste this into a BLAST search page for me
AACAGGAGGCGCTCTCTGAGGTCGCGGATCTCGCGGGAAACTCCAGGTCTGAAGCCTCAGGCAGTGGTCAGCAGACAGAATGCGACAGTGGCTTCTACCAGAATCGGTTCCAAACCGTGCTCAATTCCGCCATGCAGGATCACCATTAAAAAAAGTTCCAGTGCACAGTACTCCAGGGATGTGCCAAGCTCAGGAGATCAGAGATCAATTCCAAGGCCACCATAAAACTGCAACCATTGTCACCTATAACGACTCATTGGAGCTGTTCTTCGACAATATGTGCCACCGTCAAGAACTTGCTAAGATCCGGGTAATGCAGCTCATTAGTTGCGTGCTCTTTGCGAACAGGA

Full Affymetrix probeset data:

Annotations for 1628065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720