FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628070_at:

>probe:Drosophila_2:1628070_at:711:565; Interrogation_Position=117; Antisense; GGCAACTGCAACAAATGCGGCATCT
>probe:Drosophila_2:1628070_at:46:569; Interrogation_Position=135; Antisense; GGCATCTAGCATAGGACAACCGGGT
>probe:Drosophila_2:1628070_at:469:623; Interrogation_Position=196; Antisense; TCCACACTAACGACGGGCGGAGCAG
>probe:Drosophila_2:1628070_at:135:621; Interrogation_Position=22; Antisense; TGCCTTGCAGATGAAGTTTGCCCCT
>probe:Drosophila_2:1628070_at:431:519; Interrogation_Position=236; Antisense; GTGGAACCATTTCACCTGTCAGCGA
>probe:Drosophila_2:1628070_at:410:379; Interrogation_Position=300; Antisense; GAAGCCCTCGAGTAGCGATGCCAGT
>probe:Drosophila_2:1628070_at:403:49; Interrogation_Position=317; Antisense; ATGCCAGTGGCAGATCGGCGGCTCT
>probe:Drosophila_2:1628070_at:602:315; Interrogation_Position=349; Antisense; GCCTATGTGCACGATGTATACGAGC
>probe:Drosophila_2:1628070_at:226:89; Interrogation_Position=36; Antisense; AGTTTGCCCCTCGACAATATATGAC
>probe:Drosophila_2:1628070_at:647:103; Interrogation_Position=371; Antisense; AGCACTGTGAGGAGCCAACGGGTCC
>probe:Drosophila_2:1628070_at:386:83; Interrogation_Position=469; Antisense; AGTGGAAGGTACCTCACCCAGTGCA
>probe:Drosophila_2:1628070_at:520:129; Interrogation_Position=508; Antisense; ACCATTGGCGTGGAGCGATGCTACC
>probe:Drosophila_2:1628070_at:120:555; Interrogation_Position=519; Antisense; GGAGCGATGCTACCGCCTGAGCAAA
>probe:Drosophila_2:1628070_at:492:317; Interrogation_Position=533; Antisense; GCCTGAGCAAAGTAGCCCACGAAAA

Paste this into a BLAST search page for me
GGCAACTGCAACAAATGCGGCATCTGGCATCTAGCATAGGACAACCGGGTTCCACACTAACGACGGGCGGAGCAGTGCCTTGCAGATGAAGTTTGCCCCTGTGGAACCATTTCACCTGTCAGCGAGAAGCCCTCGAGTAGCGATGCCAGTATGCCAGTGGCAGATCGGCGGCTCTGCCTATGTGCACGATGTATACGAGCAGTTTGCCCCTCGACAATATATGACAGCACTGTGAGGAGCCAACGGGTCCAGTGGAAGGTACCTCACCCAGTGCAACCATTGGCGTGGAGCGATGCTACCGGAGCGATGCTACCGCCTGAGCAAAGCCTGAGCAAAGTAGCCCACGAAAA

Full Affymetrix probeset data:

Annotations for 1628070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720