Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628072_at:

>probe:Drosophila_2:1628072_at:380:451; Interrogation_Position=1300; Antisense; GATCGAGCGATCCTATTTGTTGTTT
>probe:Drosophila_2:1628072_at:279:727; Interrogation_Position=1316; Antisense; TTGTTGTTTGAGATCGCGCGCTGTC
>probe:Drosophila_2:1628072_at:580:489; Interrogation_Position=1338; Antisense; GTCACTTCCAGGAGTCGCGTTTCGA
>probe:Drosophila_2:1628072_at:725:327; Interrogation_Position=1354; Antisense; GCGTTTCGACAAGTGCCTCGTGGTG
>probe:Drosophila_2:1628072_at:711:659; Interrogation_Position=1393; Antisense; TAACGAGGCCCGCAGTTGCAATTGT
>probe:Drosophila_2:1628072_at:427:363; Interrogation_Position=1410; Antisense; GCAATTGTCTGATCTGGCGATTCAA
>probe:Drosophila_2:1628072_at:312:575; Interrogation_Position=1425; Antisense; GGCGATTCAACAGCATCTTCCTGGG
>probe:Drosophila_2:1628072_at:150:81; Interrogation_Position=1455; Antisense; AGGTGCATGCCGTGCTCAATCGCTT
>probe:Drosophila_2:1628072_at:210:207; Interrogation_Position=1541; Antisense; AAGCTGGTGGCCTATATAGCCATCT
>probe:Drosophila_2:1628072_at:574:27; Interrogation_Position=1556; Antisense; ATAGCCATCTGCATCAACGTTAATA
>probe:Drosophila_2:1628072_at:215:41; Interrogation_Position=1587; Antisense; ATCTGGCATTACAGCGGATCCGGCA
>probe:Drosophila_2:1628072_at:566:151; Interrogation_Position=1664; Antisense; ACATCGAATAGCTCGCAGGGATCAA
>probe:Drosophila_2:1628072_at:624:701; Interrogation_Position=1713; Antisense; TTATTTGCTCGACCAGTTGCTCTTA
>probe:Drosophila_2:1628072_at:517:705; Interrogation_Position=1735; Antisense; TTAGCTCTACATTTCACTTCAACCT

Paste this into a BLAST search page for me
GATCGAGCGATCCTATTTGTTGTTTTTGTTGTTTGAGATCGCGCGCTGTCGTCACTTCCAGGAGTCGCGTTTCGAGCGTTTCGACAAGTGCCTCGTGGTGTAACGAGGCCCGCAGTTGCAATTGTGCAATTGTCTGATCTGGCGATTCAAGGCGATTCAACAGCATCTTCCTGGGAGGTGCATGCCGTGCTCAATCGCTTAAGCTGGTGGCCTATATAGCCATCTATAGCCATCTGCATCAACGTTAATAATCTGGCATTACAGCGGATCCGGCAACATCGAATAGCTCGCAGGGATCAATTATTTGCTCGACCAGTTGCTCTTATTAGCTCTACATTTCACTTCAACCT

Full Affymetrix probeset data:

Annotations for 1628072_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime