FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628075_at:

>probe:Drosophila_2:1628075_at:458:459; Interrogation_Position=1168; Antisense; GATATTCCAGCGTGGACAGCTTGCT
>probe:Drosophila_2:1628075_at:256:665; Interrogation_Position=1222; Antisense; TACTCATCAACCTGGGCTTTGGACC
>probe:Drosophila_2:1628075_at:634:435; Interrogation_Position=1257; Antisense; GAGGATATGCTGTCGCGGATACCGC
>probe:Drosophila_2:1628075_at:560:455; Interrogation_Position=1274; Antisense; GATACCGCGGAGGTTTCTGAAGCCC
>probe:Drosophila_2:1628075_at:730:41; Interrogation_Position=1314; Antisense; ATCGATACGGATGCCTTTGTGCAAA
>probe:Drosophila_2:1628075_at:479:597; Interrogation_Position=1331; Antisense; TGTGCAAAGACTGACTCTGGCGCGA
>probe:Drosophila_2:1628075_at:718:303; Interrogation_Position=1363; Antisense; CCGATTCGAGTGTTCTGGGCTATAG
>probe:Drosophila_2:1628075_at:688:281; Interrogation_Position=1418; Antisense; CTCCTCAATTGTGGCCAGCATTATG
>probe:Drosophila_2:1628075_at:693:413; Interrogation_Position=1508; Antisense; GAGCCCTTTGAATTCTTAGCCATAC
>probe:Drosophila_2:1628075_at:5:435; Interrogation_Position=1556; Antisense; GAGGACTTTCGCTTACGTTAATTGT
>probe:Drosophila_2:1628075_at:386:681; Interrogation_Position=1594; Antisense; TATGGGTGACCTTTGACCTGTGACC
>probe:Drosophila_2:1628075_at:490:131; Interrogation_Position=1609; Antisense; ACCTGTGACCCATGTGATCATCTTG
>probe:Drosophila_2:1628075_at:620:453; Interrogation_Position=1624; Antisense; GATCATCTTGTCTTGTCCATTAGTC
>probe:Drosophila_2:1628075_at:594:85; Interrogation_Position=1655; Antisense; AGTGCCGCGTACTTAGCTGTTTAAC

Paste this into a BLAST search page for me
GATATTCCAGCGTGGACAGCTTGCTTACTCATCAACCTGGGCTTTGGACCGAGGATATGCTGTCGCGGATACCGCGATACCGCGGAGGTTTCTGAAGCCCATCGATACGGATGCCTTTGTGCAAATGTGCAAAGACTGACTCTGGCGCGACCGATTCGAGTGTTCTGGGCTATAGCTCCTCAATTGTGGCCAGCATTATGGAGCCCTTTGAATTCTTAGCCATACGAGGACTTTCGCTTACGTTAATTGTTATGGGTGACCTTTGACCTGTGACCACCTGTGACCCATGTGATCATCTTGGATCATCTTGTCTTGTCCATTAGTCAGTGCCGCGTACTTAGCTGTTTAAC

Full Affymetrix probeset data:

Annotations for 1628075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720