FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628076_at:

>probe:Drosophila_2:1628076_at:350:289; Interrogation_Position=1004; Antisense; CGGTTCTATTGTACTACGGAGCCAA
>probe:Drosophila_2:1628076_at:701:605; Interrogation_Position=1064; Antisense; TGAGAGACGAACTGCCCAACATGGC
>probe:Drosophila_2:1628076_at:105:219; Interrogation_Position=1114; Antisense; AAGTGGGCCCATCTGGATTTCATTT
>probe:Drosophila_2:1628076_at:224:671; Interrogation_Position=1159; Antisense; TACGTCTACGACGAGGTCTTGAAGC
>probe:Drosophila_2:1628076_at:47:235; Interrogation_Position=661; Antisense; AATGCCATCGTGGAGGTCTGCGGAT
>probe:Drosophila_2:1628076_at:91:449; Interrogation_Position=683; Antisense; GATCCATGGAGTTCATGCCCAGCAA
>probe:Drosophila_2:1628076_at:426:25; Interrogation_Position=730; Antisense; ATAGAGATGTGCCAGGCCACTTCTC
>probe:Drosophila_2:1628076_at:621:683; Interrogation_Position=757; Antisense; TATGCCGACATGTGCGCCAACGAGA
>probe:Drosophila_2:1628076_at:179:199; Interrogation_Position=775; Antisense; AACGAGATCTTCCTGATTGGAGGCT
>probe:Drosophila_2:1628076_at:82:57; Interrogation_Position=800; Antisense; ATGATACCGAACAGCTGGACTACGA
>probe:Drosophila_2:1628076_at:289:585; Interrogation_Position=815; Antisense; TGGACTACGAACTCCTTGAGCACAT
>probe:Drosophila_2:1628076_at:166:533; Interrogation_Position=867; Antisense; GGTGAACCAGAACTTGCACTTTTGT
>probe:Drosophila_2:1628076_at:632:467; Interrogation_Position=912; Antisense; GTTCCGTAAATTCGACTACACCGCT
>probe:Drosophila_2:1628076_at:330:275; Interrogation_Position=966; Antisense; CTTCCCTCCGGATTACAAGCTAAAG

Paste this into a BLAST search page for me
CGGTTCTATTGTACTACGGAGCCAATGAGAGACGAACTGCCCAACATGGCAAGTGGGCCCATCTGGATTTCATTTTACGTCTACGACGAGGTCTTGAAGCAATGCCATCGTGGAGGTCTGCGGATGATCCATGGAGTTCATGCCCAGCAAATAGAGATGTGCCAGGCCACTTCTCTATGCCGACATGTGCGCCAACGAGAAACGAGATCTTCCTGATTGGAGGCTATGATACCGAACAGCTGGACTACGATGGACTACGAACTCCTTGAGCACATGGTGAACCAGAACTTGCACTTTTGTGTTCCGTAAATTCGACTACACCGCTCTTCCCTCCGGATTACAAGCTAAAG

Full Affymetrix probeset data:

Annotations for 1628076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720