FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628078_at:

>probe:Drosophila_2:1628078_at:116:627; Interrogation_Position=415; Antisense; TGCCGCATCTATCGCAAGCTGGTAT
>probe:Drosophila_2:1628078_at:311:5; Interrogation_Position=532; Antisense; ATTGTGTTCCGCGAGCTGTTGCACA
>probe:Drosophila_2:1628078_at:654:603; Interrogation_Position=548; Antisense; TGTTGCACAGCACTTTCGACATCGT
>probe:Drosophila_2:1628078_at:304:401; Interrogation_Position=565; Antisense; GACATCGTCACCGAGGAGATCCTGA
>probe:Drosophila_2:1628078_at:395:587; Interrogation_Position=590; Antisense; TGGAGCGCATCTTCTGCAGCTGGGA
>probe:Drosophila_2:1628078_at:615:433; Interrogation_Position=646; Antisense; GAGGGCTGGCTCATTGGACTTTCAA
>probe:Drosophila_2:1628078_at:390:3; Interrogation_Position=658; Antisense; ATTGGACTTTCAACATTCCTGCGCG
>probe:Drosophila_2:1628078_at:643:613; Interrogation_Position=709; Antisense; TGCTTCCGGGTTTACGACCTGAACA
>probe:Drosophila_2:1628078_at:314:387; Interrogation_Position=729; Antisense; GAACACGGATGGCTTCATCACCAAG
>probe:Drosophila_2:1628078_at:312:671; Interrogation_Position=765; Antisense; TACGCTGCTGCGAAATTGCCTGATA
>probe:Drosophila_2:1628078_at:58:509; Interrogation_Position=844; Antisense; GTGCTCAAGAAGTTCGACCTGGACA
>probe:Drosophila_2:1628078_at:39:131; Interrogation_Position=910; Antisense; ACCGCGGAACCATTGCTAATCGAGG
>probe:Drosophila_2:1628078_at:242:43; Interrogation_Position=928; Antisense; ATCGAGGCATTTGGCCAGTGTCTGC
>probe:Drosophila_2:1628078_at:28:97; Interrogation_Position=957; Antisense; AGATAGCGCTGTGGTTTCCTTCTTC

Paste this into a BLAST search page for me
TGCCGCATCTATCGCAAGCTGGTATATTGTGTTCCGCGAGCTGTTGCACATGTTGCACAGCACTTTCGACATCGTGACATCGTCACCGAGGAGATCCTGATGGAGCGCATCTTCTGCAGCTGGGAGAGGGCTGGCTCATTGGACTTTCAAATTGGACTTTCAACATTCCTGCGCGTGCTTCCGGGTTTACGACCTGAACAGAACACGGATGGCTTCATCACCAAGTACGCTGCTGCGAAATTGCCTGATAGTGCTCAAGAAGTTCGACCTGGACAACCGCGGAACCATTGCTAATCGAGGATCGAGGCATTTGGCCAGTGTCTGCAGATAGCGCTGTGGTTTCCTTCTTC

Full Affymetrix probeset data:

Annotations for 1628078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720