FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628079_at:

>probe:Drosophila_2:1628079_at:701:549; Interrogation_Position=1057; Antisense; GGAGTGCTTCCCATGCGAGTGCGAT
>probe:Drosophila_2:1628079_at:545:85; Interrogation_Position=1074; Antisense; AGTGCGATCTCACCGATGTCAGCGA
>probe:Drosophila_2:1628079_at:181:517; Interrogation_Position=1118; Antisense; GTGTGCAAAATCGACGCCAATCCAT
>probe:Drosophila_2:1628079_at:283:47; Interrogation_Position=1137; Antisense; ATCCATGCTGCATTGAGATCCTCAA
>probe:Drosophila_2:1628079_at:510:359; Interrogation_Position=1162; Antisense; GCAACCAGAGTGTCCAGATCCTTAG
>probe:Drosophila_2:1628079_at:65:97; Interrogation_Position=1177; Antisense; AGATCCTTAGGAATGTAGCTGCGCT
>probe:Drosophila_2:1628079_at:115:487; Interrogation_Position=1191; Antisense; GTAGCTGCGCTATTCCACATGCATT
>probe:Drosophila_2:1628079_at:169:545; Interrogation_Position=691; Antisense; GGATAACCTGTACCCGAGTGGACCG
>probe:Drosophila_2:1628079_at:409:1; Interrogation_Position=708; Antisense; GTGGACCGGCCGTGTTTAGCTTCAA
>probe:Drosophila_2:1628079_at:389:117; Interrogation_Position=725; Antisense; AGCTTCAACAATCGATACCTTCTGC
>probe:Drosophila_2:1628079_at:302:27; Interrogation_Position=739; Antisense; ATACCTTCTGCTGGGCTATTTCCTG
>probe:Drosophila_2:1628079_at:196:283; Interrogation_Position=761; Antisense; CTGCCCGCCAGTTACAACATGAAGG
>probe:Drosophila_2:1628079_at:667:185; Interrogation_Position=865; Antisense; AACACTATGGTTCGCCCAGGAGATG
>probe:Drosophila_2:1628079_at:493:99; Interrogation_Position=885; Antisense; AGATGGCCGTGTATGACTTTTCGCT

Paste this into a BLAST search page for me
GGAGTGCTTCCCATGCGAGTGCGATAGTGCGATCTCACCGATGTCAGCGAGTGTGCAAAATCGACGCCAATCCATATCCATGCTGCATTGAGATCCTCAAGCAACCAGAGTGTCCAGATCCTTAGAGATCCTTAGGAATGTAGCTGCGCTGTAGCTGCGCTATTCCACATGCATTGGATAACCTGTACCCGAGTGGACCGGTGGACCGGCCGTGTTTAGCTTCAAAGCTTCAACAATCGATACCTTCTGCATACCTTCTGCTGGGCTATTTCCTGCTGCCCGCCAGTTACAACATGAAGGAACACTATGGTTCGCCCAGGAGATGAGATGGCCGTGTATGACTTTTCGCT

Full Affymetrix probeset data:

Annotations for 1628079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720