FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628080_at:

>probe:Drosophila_2:1628080_at:146:399; Interrogation_Position=1043; Antisense; GACACCACGTCTATGTATTAGGCTA
>probe:Drosophila_2:1628080_at:637:185; Interrogation_Position=1134; Antisense; AACACACCTAGTTGTAGTCACTCAA
>probe:Drosophila_2:1628080_at:395:89; Interrogation_Position=1149; Antisense; AGTCACTCAATCTAGTTTAGGCCAA
>probe:Drosophila_2:1628080_at:529:199; Interrogation_Position=1172; Antisense; AACGAATCGATAACAGGCTGCCAGA
>probe:Drosophila_2:1628080_at:665:147; Interrogation_Position=1215; Antisense; ACTAGCTGTAGACCCCATAGATACC
>probe:Drosophila_2:1628080_at:290:675; Interrogation_Position=1232; Antisense; TAGATACCCTATAAACCACCTGTGC
>probe:Drosophila_2:1628080_at:242:129; Interrogation_Position=1246; Antisense; ACCACCTGTGCGTAATTAGTTGTAG
>probe:Drosophila_2:1628080_at:558:217; Interrogation_Position=733; Antisense; AAGGCCGAGACCGTTTGCGTTCAGC
>probe:Drosophila_2:1628080_at:399:169; Interrogation_Position=771; Antisense; AAAGGAGACCGATCCGTGCCTCAAG
>probe:Drosophila_2:1628080_at:94:77; Interrogation_Position=797; Antisense; AGGAGGTGCGTCACAAGGCCTTCCT
>probe:Drosophila_2:1628080_at:105:657; Interrogation_Position=841; Antisense; TAAGAGACCTAGTTGGCCCACGACG
>probe:Drosophila_2:1628080_at:375:19; Interrogation_Position=876; Antisense; ATTTGTGTATCCCAAAGTCGCCTGC
>probe:Drosophila_2:1628080_at:59:221; Interrogation_Position=907; Antisense; AAGGAGCTAACCAAACATACCGCCA
>probe:Drosophila_2:1628080_at:39:29; Interrogation_Position=923; Antisense; ATACCGCCACATAGTGCTGCAATTG

Paste this into a BLAST search page for me
GACACCACGTCTATGTATTAGGCTAAACACACCTAGTTGTAGTCACTCAAAGTCACTCAATCTAGTTTAGGCCAAAACGAATCGATAACAGGCTGCCAGAACTAGCTGTAGACCCCATAGATACCTAGATACCCTATAAACCACCTGTGCACCACCTGTGCGTAATTAGTTGTAGAAGGCCGAGACCGTTTGCGTTCAGCAAAGGAGACCGATCCGTGCCTCAAGAGGAGGTGCGTCACAAGGCCTTCCTTAAGAGACCTAGTTGGCCCACGACGATTTGTGTATCCCAAAGTCGCCTGCAAGGAGCTAACCAAACATACCGCCAATACCGCCACATAGTGCTGCAATTG

Full Affymetrix probeset data:

Annotations for 1628080_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720