FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628083_at:

>probe:Drosophila_2:1628083_at:611:629; Interrogation_Position=2311; Antisense; TCCAGGGTCCGCGAGATTGTCAACC
>probe:Drosophila_2:1628083_at:485:201; Interrogation_Position=2332; Antisense; AACCGGAACATGATCGAGCCCACGA
>probe:Drosophila_2:1628083_at:361:715; Interrogation_Position=2365; Antisense; TTCGACGAAGCTCAAATCCAGATCT
>probe:Drosophila_2:1628083_at:584:211; Interrogation_Position=2462; Antisense; AAGACAACTCGAATGCCGGTTCCAA
>probe:Drosophila_2:1628083_at:130:297; Interrogation_Position=2476; Antisense; GCCGGTTCCAAAGCGGATAGTCCAA
>probe:Drosophila_2:1628083_at:637:99; Interrogation_Position=2506; Antisense; AGAGGATGGCTTGATGTCCCGGATC
>probe:Drosophila_2:1628083_at:612:245; Interrogation_Position=2555; Antisense; AATTCAGTTGCGCTGTGTTGACTTC
>probe:Drosophila_2:1628083_at:160:339; Interrogation_Position=2587; Antisense; GCTCTCCACTGGTATATCTCTGATT
>probe:Drosophila_2:1628083_at:376:249; Interrogation_Position=2620; Antisense; CAATCGCTGCTGCAATCGACTAAGC
>probe:Drosophila_2:1628083_at:15:381; Interrogation_Position=2663; Antisense; GAACCATTTAACCATTTTGCGAGCA
>probe:Drosophila_2:1628083_at:226:693; Interrogation_Position=2678; Antisense; TTTGCGAGCAGCCACGAAATCAGGA
>probe:Drosophila_2:1628083_at:579:365; Interrogation_Position=2720; Antisense; GAATCAGACGTCGTGCGTTCAATGT
>probe:Drosophila_2:1628083_at:429:1; Interrogation_Position=2762; Antisense; CTTCCTACGTTCTAGTCGTTAGCTA
>probe:Drosophila_2:1628083_at:129:349; Interrogation_Position=2828; Antisense; GCAGGTTCGACCACAGAAAGCATTT

Paste this into a BLAST search page for me
TCCAGGGTCCGCGAGATTGTCAACCAACCGGAACATGATCGAGCCCACGATTCGACGAAGCTCAAATCCAGATCTAAGACAACTCGAATGCCGGTTCCAAGCCGGTTCCAAAGCGGATAGTCCAAAGAGGATGGCTTGATGTCCCGGATCAATTCAGTTGCGCTGTGTTGACTTCGCTCTCCACTGGTATATCTCTGATTCAATCGCTGCTGCAATCGACTAAGCGAACCATTTAACCATTTTGCGAGCATTTGCGAGCAGCCACGAAATCAGGAGAATCAGACGTCGTGCGTTCAATGTCTTCCTACGTTCTAGTCGTTAGCTAGCAGGTTCGACCACAGAAAGCATTT

Full Affymetrix probeset data:

Annotations for 1628083_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720