FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628084_at:

>probe:Drosophila_2:1628084_at:656:293; Interrogation_Position=27; Antisense; CGAGCAGATCATAAGTAACCAACCT
>probe:Drosophila_2:1628084_at:706:47; Interrogation_Position=279; Antisense; ATCCATCTTCACTGAGTTCTTCTGG
>probe:Drosophila_2:1628084_at:524:711; Interrogation_Position=286; Antisense; TTCACTGAGTTCTTCTGGGACATCC
>probe:Drosophila_2:1628084_at:258:295; Interrogation_Position=319; Antisense; CGAGTATCTGTGATGTGACCCGATC
>probe:Drosophila_2:1628084_at:715:169; Interrogation_Position=345; Antisense; AAAGGTCTATAAATCGGCACTCCGG
>probe:Drosophila_2:1628084_at:5:281; Interrogation_Position=364; Antisense; CTCCGGCTTTAATATCCAACTGTGA
>probe:Drosophila_2:1628084_at:430:409; Interrogation_Position=390; Antisense; GACGAGAACACAAGACTGACTGACT
>probe:Drosophila_2:1628084_at:374:143; Interrogation_Position=404; Antisense; ACTGACTGACTTGTGTGCCTTGGAG
>probe:Drosophila_2:1628084_at:684:79; Interrogation_Position=427; Antisense; AGGTGACAAAGTTCGTCGCCTCTGC
>probe:Drosophila_2:1628084_at:641:201; Interrogation_Position=43; Antisense; AACCAACCTGCAAAATGTTCACCGA
>probe:Drosophila_2:1628084_at:23:317; Interrogation_Position=444; Antisense; GCCTCTGCCAACTGTACATATCAAA
>probe:Drosophila_2:1628084_at:237:191; Interrogation_Position=467; Antisense; AACTAGCTGCTAAAATGTCTTCAAT
>probe:Drosophila_2:1628084_at:73:483; Interrogation_Position=516; Antisense; GTATTATCATTGTCTTCCATTAGTT
>probe:Drosophila_2:1628084_at:252:341; Interrogation_Position=590; Antisense; GCTTAAGAATAAAAATCCCTCGCGG

Paste this into a BLAST search page for me
CGAGCAGATCATAAGTAACCAACCTATCCATCTTCACTGAGTTCTTCTGGTTCACTGAGTTCTTCTGGGACATCCCGAGTATCTGTGATGTGACCCGATCAAAGGTCTATAAATCGGCACTCCGGCTCCGGCTTTAATATCCAACTGTGAGACGAGAACACAAGACTGACTGACTACTGACTGACTTGTGTGCCTTGGAGAGGTGACAAAGTTCGTCGCCTCTGCAACCAACCTGCAAAATGTTCACCGAGCCTCTGCCAACTGTACATATCAAAAACTAGCTGCTAAAATGTCTTCAATGTATTATCATTGTCTTCCATTAGTTGCTTAAGAATAAAAATCCCTCGCGG

Full Affymetrix probeset data:

Annotations for 1628084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720