Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628085_at:

>probe:Drosophila_2:1628085_at:182:569; Interrogation_Position=329; Antisense; GGCAGTACGAGTTCAGATATCAGCT
>probe:Drosophila_2:1628085_at:348:333; Interrogation_Position=351; Antisense; GCTGGATAATGGCAACACGCGATAT
>probe:Drosophila_2:1628085_at:614:361; Interrogation_Position=401; Antisense; GCAAGGATCTCGTTCTGGCCAAGAA
>probe:Drosophila_2:1628085_at:321:223; Interrogation_Position=424; Antisense; AAGGGATACTATTCGGTGCCACTGC
>probe:Drosophila_2:1628085_at:444:453; Interrogation_Position=484; Antisense; GATCATCGTGGCTACCATGTGGACA
>probe:Drosophila_2:1628085_at:20:403; Interrogation_Position=513; Antisense; GACATTATCCGTAGAGCAGCCGCTA
>probe:Drosophila_2:1628085_at:123:63; Interrogation_Position=595; Antisense; ATGGGCACCGGAATAGCCACGGGTA
>probe:Drosophila_2:1628085_at:10:247; Interrogation_Position=634; Antisense; AATTCAATAAGCGACCCGGAGCGTA
>probe:Drosophila_2:1628085_at:99:123; Interrogation_Position=653; Antisense; AGCGTAACGAGCTGCCTGTGGAAGT
>probe:Drosophila_2:1628085_at:635:135; Interrogation_Position=716; Antisense; ACGCAAGTGATGCTGGCACCGAGCT
>probe:Drosophila_2:1628085_at:83:133; Interrogation_Position=733; Antisense; ACCGAGCTGGTTCCTAATGCTGTAA
>probe:Drosophila_2:1628085_at:364:389; Interrogation_Position=772; Antisense; GAAACCGAACCATCAACTTTGGCCA
>probe:Drosophila_2:1628085_at:149:127; Interrogation_Position=797; Antisense; ACGACATTTTGGCAACTGGAGCACC
>probe:Drosophila_2:1628085_at:333:261; Interrogation_Position=818; Antisense; CACCAGCCGACAGCCATGATGATGA

Paste this into a BLAST search page for me
GGCAGTACGAGTTCAGATATCAGCTGCTGGATAATGGCAACACGCGATATGCAAGGATCTCGTTCTGGCCAAGAAAAGGGATACTATTCGGTGCCACTGCGATCATCGTGGCTACCATGTGGACAGACATTATCCGTAGAGCAGCCGCTAATGGGCACCGGAATAGCCACGGGTAAATTCAATAAGCGACCCGGAGCGTAAGCGTAACGAGCTGCCTGTGGAAGTACGCAAGTGATGCTGGCACCGAGCTACCGAGCTGGTTCCTAATGCTGTAAGAAACCGAACCATCAACTTTGGCCAACGACATTTTGGCAACTGGAGCACCCACCAGCCGACAGCCATGATGATGA

Full Affymetrix probeset data:

Annotations for 1628085_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime