FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628086_at:

>probe:Drosophila_2:1628086_at:201:377; Interrogation_Position=277; Antisense; GAAGAATCTCATTCGCAGCGCGAGG
>probe:Drosophila_2:1628086_at:481:419; Interrogation_Position=301; Antisense; GAGCATGTGGAAACCTACAGCCTTA
>probe:Drosophila_2:1628086_at:423:329; Interrogation_Position=346; Antisense; GCGGTGGAGCCGAAGCCCAAGAACT
>probe:Drosophila_2:1628086_at:185:21; Interrogation_Position=386; Antisense; ATTTGGACGTGGACTCCCAGCCGGA
>probe:Drosophila_2:1628086_at:68:389; Interrogation_Position=417; Antisense; GAAAATGTCTGGATTGCCCACTGCC
>probe:Drosophila_2:1628086_at:404:575; Interrogation_Position=483; Antisense; GGCGCCGGATAAGCCATTATTGCCG
>probe:Drosophila_2:1628086_at:451:701; Interrogation_Position=499; Antisense; TTATTGCCGGAAGAATGCGTCTCTC
>probe:Drosophila_2:1628086_at:112:47; Interrogation_Position=554; Antisense; ATCCGCTGGACACGTCGCTGGTGAA
>probe:Drosophila_2:1628086_at:430:551; Interrogation_Position=590; Antisense; GGAGATCGCGGACGAACTTCACCCT
>probe:Drosophila_2:1628086_at:258:121; Interrogation_Position=635; Antisense; AGCGACTGTTCGAGGAGACCCACTA
>probe:Drosophila_2:1628086_at:603:315; Interrogation_Position=667; Antisense; GCCTTCATGCGCGAGGAACTGAGTC
>probe:Drosophila_2:1628086_at:710:405; Interrogation_Position=695; Antisense; GACTGGGCCTCAGCGAAGCTAGAGT
>probe:Drosophila_2:1628086_at:386:685; Interrogation_Position=755; Antisense; TATACCCCGATTGCAACATGACATT
>probe:Drosophila_2:1628086_at:143:399; Interrogation_Position=805; Antisense; GACACCACGAGGTCCAAATTGTTTT

Paste this into a BLAST search page for me
GAAGAATCTCATTCGCAGCGCGAGGGAGCATGTGGAAACCTACAGCCTTAGCGGTGGAGCCGAAGCCCAAGAACTATTTGGACGTGGACTCCCAGCCGGAGAAAATGTCTGGATTGCCCACTGCCGGCGCCGGATAAGCCATTATTGCCGTTATTGCCGGAAGAATGCGTCTCTCATCCGCTGGACACGTCGCTGGTGAAGGAGATCGCGGACGAACTTCACCCTAGCGACTGTTCGAGGAGACCCACTAGCCTTCATGCGCGAGGAACTGAGTCGACTGGGCCTCAGCGAAGCTAGAGTTATACCCCGATTGCAACATGACATTGACACCACGAGGTCCAAATTGTTTT

Full Affymetrix probeset data:

Annotations for 1628086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720