Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628087_s_at:

>probe:Drosophila_2:1628087_s_at:525:143; Interrogation_Position=182; Antisense; ACTCGGAGGGCCACCAGTCGAATGT
>probe:Drosophila_2:1628087_s_at:376:87; Interrogation_Position=197; Antisense; AGTCGAATGTCCATCCCGTGAATGC
>probe:Drosophila_2:1628087_s_at:629:607; Interrogation_Position=230; Antisense; TGAGGCGTCTGCGTCGTCAGTCCAG
>probe:Drosophila_2:1628087_s_at:495:515; Interrogation_Position=290; Antisense; GTGGAGGAAACGTCTTCACCTACGC
>probe:Drosophila_2:1628087_s_at:720:261; Interrogation_Position=328; Antisense; CAGAATGCCGATGGCTCCGGTCATT
>probe:Drosophila_2:1628087_s_at:272:593; Interrogation_Position=401; Antisense; TGTCCTTTGATGAGCGTTTCGGCGA
>probe:Drosophila_2:1628087_s_at:292:425; Interrogation_Position=424; Antisense; GAGAGCTCCTTAACTGGAGGCGACA
>probe:Drosophila_2:1628087_s_at:697:547; Interrogation_Position=439; Antisense; GGAGGCGACAACTATTATCCCACCT
>probe:Drosophila_2:1628087_s_at:412:377; Interrogation_Position=512; Antisense; GAAGCACCGGTAGCTATCAGCACAT
>probe:Drosophila_2:1628087_s_at:336:681; Interrogation_Position=526; Antisense; TATCAGCACATCTCCGGAGTTGGAC
>probe:Drosophila_2:1628087_s_at:46:165; Interrogation_Position=566; Antisense; AAATCCAGCAGACCGTGGCCGTTGT
>probe:Drosophila_2:1628087_s_at:431:223; Interrogation_Position=610; Antisense; AAGGTGACCAACATCCAGGGTGCCA
>probe:Drosophila_2:1628087_s_at:621:719; Interrogation_Position=639; Antisense; TTCCAACGGCGTTCTCAATATCAAG
>probe:Drosophila_2:1628087_s_at:623:295; Interrogation_Position=669; Antisense; CGAATCCACTTACTCATCCAAATAG

Paste this into a BLAST search page for me
ACTCGGAGGGCCACCAGTCGAATGTAGTCGAATGTCCATCCCGTGAATGCTGAGGCGTCTGCGTCGTCAGTCCAGGTGGAGGAAACGTCTTCACCTACGCCAGAATGCCGATGGCTCCGGTCATTTGTCCTTTGATGAGCGTTTCGGCGAGAGAGCTCCTTAACTGGAGGCGACAGGAGGCGACAACTATTATCCCACCTGAAGCACCGGTAGCTATCAGCACATTATCAGCACATCTCCGGAGTTGGACAAATCCAGCAGACCGTGGCCGTTGTAAGGTGACCAACATCCAGGGTGCCATTCCAACGGCGTTCTCAATATCAAGCGAATCCACTTACTCATCCAAATAG

Full Affymetrix probeset data:

Annotations for 1628087_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime