FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628088_at:

>probe:Drosophila_2:1628088_at:478:613; Interrogation_Position=160; Antisense; TGAAGAACGGCACCCAGATCCACGG
>probe:Drosophila_2:1628088_at:385:141; Interrogation_Position=181; Antisense; ACGGCACCATTACCGGCGTGGATGT
>probe:Drosophila_2:1628088_at:548:63; Interrogation_Position=202; Antisense; ATGTGGCCATGAACACTCACCTGAA
>probe:Drosophila_2:1628088_at:15:213; Interrogation_Position=225; Antisense; AAGAGCGTTCGGATGACGATCAAGA
>probe:Drosophila_2:1628088_at:549:103; Interrogation_Position=271; Antisense; AGACGCTGAGCATTCGCGGCAACAA
>probe:Drosophila_2:1628088_at:144:457; Interrogation_Position=301; Antisense; GATACTTTATACTGCCGGACAGCCT
>probe:Drosophila_2:1628088_at:699:585; Interrogation_Position=331; Antisense; TGGAGACGCTCCTCATCGACGACAC
>probe:Drosophila_2:1628088_at:551:253; Interrogation_Position=370; Antisense; CAAAAAAGAAGGACAGCGGCCGCGT
>probe:Drosophila_2:1628088_at:79:417; Interrogation_Position=460; Antisense; GAGCTTCAGGCCGACGTTAATCTTT
>probe:Drosophila_2:1628088_at:296:543; Interrogation_Position=541; Antisense; GGATAAATCCACACTGTATGCATTT
>probe:Drosophila_2:1628088_at:284:611; Interrogation_Position=582; Antisense; TGACAAATGTCTTCAGCTAGTAAAG
>probe:Drosophila_2:1628088_at:644:163; Interrogation_Position=636; Antisense; AAATCACTCTGTGTAGTAGCTCAGG
>probe:Drosophila_2:1628088_at:526:245; Interrogation_Position=684; Antisense; AATTGAAAGAAGACTCCCGCCATTA
>probe:Drosophila_2:1628088_at:94:377; Interrogation_Position=692; Antisense; GAAGACTCCCGCCATTAAATTATGA

Paste this into a BLAST search page for me
TGAAGAACGGCACCCAGATCCACGGACGGCACCATTACCGGCGTGGATGTATGTGGCCATGAACACTCACCTGAAAAGAGCGTTCGGATGACGATCAAGAAGACGCTGAGCATTCGCGGCAACAAGATACTTTATACTGCCGGACAGCCTTGGAGACGCTCCTCATCGACGACACCAAAAAAGAAGGACAGCGGCCGCGTGAGCTTCAGGCCGACGTTAATCTTTGGATAAATCCACACTGTATGCATTTTGACAAATGTCTTCAGCTAGTAAAGAAATCACTCTGTGTAGTAGCTCAGGAATTGAAAGAAGACTCCCGCCATTAGAAGACTCCCGCCATTAAATTATGA

Full Affymetrix probeset data:

Annotations for 1628088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720