Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628089_at:

>probe:Drosophila_2:1628089_at:156:339; Interrogation_Position=2261; Antisense; GCTACAGCTGCAAGTTCTGCGGCAA
>probe:Drosophila_2:1628089_at:233:251; Interrogation_Position=2283; Antisense; CAAGGTGTTCCCCAGATCGGCCAAT
>probe:Drosophila_2:1628089_at:263:641; Interrogation_Position=2299; Antisense; TCGGCCAATCTGACGAGGCATTTGA
>probe:Drosophila_2:1628089_at:118:523; Interrogation_Position=2369; Antisense; GGGCATTCAGTATATCCTCGAACCT
>probe:Drosophila_2:1628089_at:249:203; Interrogation_Position=2389; Antisense; AACCTGCAGCGCCATGTGAGGAACA
>probe:Drosophila_2:1628089_at:253:161; Interrogation_Position=2420; Antisense; ACAAGGAGCGTCCTTTTCGCTGCGA
>probe:Drosophila_2:1628089_at:727:335; Interrogation_Position=2438; Antisense; GCTGCGAGCTCTGCGATAGATCCTT
>probe:Drosophila_2:1628089_at:315:457; Interrogation_Position=2452; Antisense; GATAGATCCTTTGGCCAGCAGACGA
>probe:Drosophila_2:1628089_at:708:349; Interrogation_Position=2469; Antisense; GCAGACGAATCTCGATCGGCACGTA
>probe:Drosophila_2:1628089_at:79:433; Interrogation_Position=2509; Antisense; GAGGGCAACAATTTCCGGGATTCGC
>probe:Drosophila_2:1628089_at:222:93; Interrogation_Position=2585; Antisense; AGTTCATGAACCGAGTCTACACGCC
>probe:Drosophila_2:1628089_at:193:437; Interrogation_Position=2641; Antisense; GAGGAGTATCCCAATAGCGACGATC
>probe:Drosophila_2:1628089_at:412:323; Interrogation_Position=2657; Antisense; GCGACGATCAGTCCGTCAATCTGGA
>probe:Drosophila_2:1628089_at:30:159; Interrogation_Position=2753; Antisense; ACAACAGCTCCAAGGCCATTACAAT

Paste this into a BLAST search page for me
GCTACAGCTGCAAGTTCTGCGGCAACAAGGTGTTCCCCAGATCGGCCAATTCGGCCAATCTGACGAGGCATTTGAGGGCATTCAGTATATCCTCGAACCTAACCTGCAGCGCCATGTGAGGAACAACAAGGAGCGTCCTTTTCGCTGCGAGCTGCGAGCTCTGCGATAGATCCTTGATAGATCCTTTGGCCAGCAGACGAGCAGACGAATCTCGATCGGCACGTAGAGGGCAACAATTTCCGGGATTCGCAGTTCATGAACCGAGTCTACACGCCGAGGAGTATCCCAATAGCGACGATCGCGACGATCAGTCCGTCAATCTGGAACAACAGCTCCAAGGCCATTACAAT

Full Affymetrix probeset data:

Annotations for 1628089_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime