FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628091_at:

>probe:Drosophila_2:1628091_at:250:175; Interrogation_Position=3422; Antisense; AAAGCCAAAGCTTCTCGCGCATCTT
>probe:Drosophila_2:1628091_at:721:641; Interrogation_Position=3434; Antisense; TCTCGCGCATCTTGGCGGATGAAAA
>probe:Drosophila_2:1628091_at:623:99; Interrogation_Position=3464; Antisense; AGAGGGAATCCTATGAGCGCATGCG
>probe:Drosophila_2:1628091_at:5:125; Interrogation_Position=3479; Antisense; AGCGCATGCGGAACAAATCTTTGGT
>probe:Drosophila_2:1628091_at:626:277; Interrogation_Position=3497; Antisense; CTTTGGTACACACGCAGATTGAGGA
>probe:Drosophila_2:1628091_at:380:433; Interrogation_Position=3540; Antisense; GAGGGAGTTCTACAACGTGGACAAC
>probe:Drosophila_2:1628091_at:174:423; Interrogation_Position=3574; Antisense; GAGACTATAACCATTGCCCGAGTGT
>probe:Drosophila_2:1628091_at:613:83; Interrogation_Position=3594; Antisense; AGTGTCCAGACCCAGTGATATCAAC
>probe:Drosophila_2:1628091_at:602:423; Interrogation_Position=3701; Antisense; GAGTGTTCGGACTGTTTGTGTTTTT
>probe:Drosophila_2:1628091_at:456:697; Interrogation_Position=3723; Antisense; TTTAAAGCGATTTACTGCGACCGGG
>probe:Drosophila_2:1628091_at:401:651; Interrogation_Position=3751; Antisense; TCAAATGTAGAACTCGGATCCGCCT
>probe:Drosophila_2:1628091_at:227:449; Interrogation_Position=3767; Antisense; GATCCGCCTGCAAAGAAGCTCTTGC
>probe:Drosophila_2:1628091_at:33:445; Interrogation_Position=3824; Antisense; GATATTGGACGGCACATTGGGTAAC
>probe:Drosophila_2:1628091_at:96:395; Interrogation_Position=3988; Antisense; GAAATAAACCCGTTGCTTATGCAAA

Paste this into a BLAST search page for me
AAAGCCAAAGCTTCTCGCGCATCTTTCTCGCGCATCTTGGCGGATGAAAAAGAGGGAATCCTATGAGCGCATGCGAGCGCATGCGGAACAAATCTTTGGTCTTTGGTACACACGCAGATTGAGGAGAGGGAGTTCTACAACGTGGACAACGAGACTATAACCATTGCCCGAGTGTAGTGTCCAGACCCAGTGATATCAACGAGTGTTCGGACTGTTTGTGTTTTTTTTAAAGCGATTTACTGCGACCGGGTCAAATGTAGAACTCGGATCCGCCTGATCCGCCTGCAAAGAAGCTCTTGCGATATTGGACGGCACATTGGGTAACGAAATAAACCCGTTGCTTATGCAAA

Full Affymetrix probeset data:

Annotations for 1628091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720