FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628092_at:

>probe:Drosophila_2:1628092_at:177:63; Interrogation_Position=417; Antisense; ATGTCCATGGCGCTGTGCTACATAT
>probe:Drosophila_2:1628092_at:70:509; Interrogation_Position=431; Antisense; GTGCTACATATCAAGGCTCCAGAGG
>probe:Drosophila_2:1628092_at:353:99; Interrogation_Position=451; Antisense; AGAGGAATCTGGCTCCTGGCGTCAA
>probe:Drosophila_2:1628092_at:225:313; Interrogation_Position=519; Antisense; GCCTCGCAGTACATGACGTTCATGA
>probe:Drosophila_2:1628092_at:112:137; Interrogation_Position=534; Antisense; ACGTTCATGAACGTCTTCTTCACCG
>probe:Drosophila_2:1628092_at:31:197; Interrogation_Position=565; Antisense; AACTGGGCATCACGATCGATACCTG
>probe:Drosophila_2:1628092_at:312:213; Interrogation_Position=600; Antisense; AAGACCCTCAGTTTGCTACAGCAAG
>probe:Drosophila_2:1628092_at:310:227; Interrogation_Position=622; Antisense; AAGGCTGTGACATTACCTCCGGACA
>probe:Drosophila_2:1628092_at:77:97; Interrogation_Position=715; Antisense; AGATCCGTCACAAATTGGTCCTGCC
>probe:Drosophila_2:1628092_at:163:643; Interrogation_Position=775; Antisense; TCTGCCATCGTGAGCTGATCGACAT
>probe:Drosophila_2:1628092_at:126:151; Interrogation_Position=796; Antisense; ACATTGGCTACGTCTGCTCGGTTTG
>probe:Drosophila_2:1628092_at:659:315; Interrogation_Position=820; Antisense; GCCTCTCGGTCTTCTGCAAATACAG
>probe:Drosophila_2:1628092_at:290:241; Interrogation_Position=838; Antisense; AATACAGTCCCATATGCACCACTTG
>probe:Drosophila_2:1628092_at:396:717; Interrogation_Position=860; Antisense; TTGCCACACCATTTTCAAGAATCCC

Paste this into a BLAST search page for me
ATGTCCATGGCGCTGTGCTACATATGTGCTACATATCAAGGCTCCAGAGGAGAGGAATCTGGCTCCTGGCGTCAAGCCTCGCAGTACATGACGTTCATGAACGTTCATGAACGTCTTCTTCACCGAACTGGGCATCACGATCGATACCTGAAGACCCTCAGTTTGCTACAGCAAGAAGGCTGTGACATTACCTCCGGACAAGATCCGTCACAAATTGGTCCTGCCTCTGCCATCGTGAGCTGATCGACATACATTGGCTACGTCTGCTCGGTTTGGCCTCTCGGTCTTCTGCAAATACAGAATACAGTCCCATATGCACCACTTGTTGCCACACCATTTTCAAGAATCCC

Full Affymetrix probeset data:

Annotations for 1628092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720