FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628094_at:

>probe:Drosophila_2:1628094_at:599:559; Interrogation_Position=477; Antisense; GGAAAGTCGTGCCATACTCTCCTAT
>probe:Drosophila_2:1628094_at:222:101; Interrogation_Position=521; Antisense; AGAGTGACCAACTGTATCCCACGGA
>probe:Drosophila_2:1628094_at:276:201; Interrogation_Position=572; Antisense; AACGCCTCCAGTTCGATTTGGGCAC
>probe:Drosophila_2:1628094_at:623:19; Interrogation_Position=587; Antisense; ATTTGGGCACCCTATACATGCGACT
>probe:Drosophila_2:1628094_at:662:27; Interrogation_Position=600; Antisense; ATACATGCGACTCACGGACTACTAT
>probe:Drosophila_2:1628094_at:447:557; Interrogation_Position=615; Antisense; GGACTACTATTTCCCCACAATGTTT
>probe:Drosophila_2:1628094_at:500:161; Interrogation_Position=631; Antisense; ACAATGTTTATTGGTGCGCCCCTGG
>probe:Drosophila_2:1628094_at:388:595; Interrogation_Position=689; Antisense; TGGGCTGGCTAAACACAATCTTGGA
>probe:Drosophila_2:1628094_at:325:453; Interrogation_Position=754; Antisense; GATCTCACGCTTTTGGTGACCGTTT
>probe:Drosophila_2:1628094_at:434:333; Interrogation_Position=783; Antisense; GCTGGAGGCCTTCGAATTTGAACTT
>probe:Drosophila_2:1628094_at:38:1; Interrogation_Position=804; Antisense; ACTTCGACCCTATAAACATATCCGC
>probe:Drosophila_2:1628094_at:368:309; Interrogation_Position=828; Antisense; CCAATGGCTCGATCGCTGCAAGGAT
>probe:Drosophila_2:1628094_at:36:79; Interrogation_Position=848; Antisense; AGGATCACATGGCACCGTTTGACTA
>probe:Drosophila_2:1628094_at:646:235; Interrogation_Position=934; Antisense; CAATCGGCGGGCTAACAGTTCTTTA

Paste this into a BLAST search page for me
GGAAAGTCGTGCCATACTCTCCTATAGAGTGACCAACTGTATCCCACGGAAACGCCTCCAGTTCGATTTGGGCACATTTGGGCACCCTATACATGCGACTATACATGCGACTCACGGACTACTATGGACTACTATTTCCCCACAATGTTTACAATGTTTATTGGTGCGCCCCTGGTGGGCTGGCTAAACACAATCTTGGAGATCTCACGCTTTTGGTGACCGTTTGCTGGAGGCCTTCGAATTTGAACTTACTTCGACCCTATAAACATATCCGCCCAATGGCTCGATCGCTGCAAGGATAGGATCACATGGCACCGTTTGACTACAATCGGCGGGCTAACAGTTCTTTA

Full Affymetrix probeset data:

Annotations for 1628094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720