Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628095_at:

>probe:Drosophila_2:1628095_at:238:223; Interrogation_Position=1006; Antisense; AAGGGATTCAACAGTGCCGCGTCCG
>probe:Drosophila_2:1628095_at:441:507; Interrogation_Position=1019; Antisense; GTGCCGCGTCCGAAACATACAGTGG
>probe:Drosophila_2:1628095_at:425:29; Interrogation_Position=1035; Antisense; ATACAGTGGCGTCGATAGCTACAAC
>probe:Drosophila_2:1628095_at:482:253; Interrogation_Position=1056; Antisense; CAACGTGGGTCATGTTCAGGGCTAT
>probe:Drosophila_2:1628095_at:560:545; Interrogation_Position=1081; Antisense; GGATCCAGTAGCTATCACCAGTACA
>probe:Drosophila_2:1628095_at:611:127; Interrogation_Position=1097; Antisense; ACCAGTACAGTGGTGGGCCCTATCT
>probe:Drosophila_2:1628095_at:474:645; Interrogation_Position=552; Antisense; TCATACTCACCATCCGGTTGAGGAG
>probe:Drosophila_2:1628095_at:384:199; Interrogation_Position=665; Antisense; AACCCGCACCAGTGGAGGAGCACAT
>probe:Drosophila_2:1628095_at:83:77; Interrogation_Position=680; Antisense; AGGAGCACATCGACCAGGAGCCGGA
>probe:Drosophila_2:1628095_at:31:33; Interrogation_Position=713; Antisense; ATAAGTATTCGCCACACAGTCACGC
>probe:Drosophila_2:1628095_at:574:663; Interrogation_Position=799; Antisense; TACACTCTCGAAGCTCCGCAGGAAT
>probe:Drosophila_2:1628095_at:203:563; Interrogation_Position=819; Antisense; GGAATCCTCCTTCGGATACGATTAC
>probe:Drosophila_2:1628095_at:607:541; Interrogation_Position=921; Antisense; GGAACCGGCGGACACCTATGGACCA
>probe:Drosophila_2:1628095_at:77:465; Interrogation_Position=991; Antisense; GATTGGCCCGAGTCCAAGGGATTCA

Paste this into a BLAST search page for me
AAGGGATTCAACAGTGCCGCGTCCGGTGCCGCGTCCGAAACATACAGTGGATACAGTGGCGTCGATAGCTACAACCAACGTGGGTCATGTTCAGGGCTATGGATCCAGTAGCTATCACCAGTACAACCAGTACAGTGGTGGGCCCTATCTTCATACTCACCATCCGGTTGAGGAGAACCCGCACCAGTGGAGGAGCACATAGGAGCACATCGACCAGGAGCCGGAATAAGTATTCGCCACACAGTCACGCTACACTCTCGAAGCTCCGCAGGAATGGAATCCTCCTTCGGATACGATTACGGAACCGGCGGACACCTATGGACCAGATTGGCCCGAGTCCAAGGGATTCA

Full Affymetrix probeset data:

Annotations for 1628095_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime