FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628096_at:

>probe:Drosophila_2:1628096_at:367:163; Interrogation_Position=1005; Antisense; AAAGCTGTCGCTCAAATAACGGGAT
>probe:Drosophila_2:1628096_at:100:33; Interrogation_Position=1114; Antisense; ATCACATTTCTTTTAGCTTGGCCCA
>probe:Drosophila_2:1628096_at:718:581; Interrogation_Position=1132; Antisense; TGGCCCAAGCCCACTTAATATACAA
>probe:Drosophila_2:1628096_at:637:223; Interrogation_Position=595; Antisense; AAGGTCTCCGACGATGAAATGCATG
>probe:Drosophila_2:1628096_at:614:167; Interrogation_Position=611; Antisense; AAATGCATGAGAATTCCACCACGGA
>probe:Drosophila_2:1628096_at:404:235; Interrogation_Position=691; Antisense; CAGACTTCCGCCGAGTACGTTTACG
>probe:Drosophila_2:1628096_at:450:367; Interrogation_Position=726; Antisense; GAACAAAACGGACATTGACCCGCTT
>probe:Drosophila_2:1628096_at:541:725; Interrogation_Position=740; Antisense; TTGACCCGCTTTACCTGCAATCTAA
>probe:Drosophila_2:1628096_at:14:617; Interrogation_Position=755; Antisense; TGCAATCTAACAAACGGGCCGCATT
>probe:Drosophila_2:1628096_at:687:75; Interrogation_Position=803; Antisense; AGGAGACCACACTGCTTGACAAGAT
>probe:Drosophila_2:1628096_at:573:393; Interrogation_Position=841; Antisense; GAAATGGTGCACGATACCGCCAACA
>probe:Drosophila_2:1628096_at:103:189; Interrogation_Position=862; Antisense; AACAGCGTTCAACTTGCACTCAATG
>probe:Drosophila_2:1628096_at:66:365; Interrogation_Position=886; Antisense; GAATTTTTTGTCCTGTACAAGCAGA
>probe:Drosophila_2:1628096_at:475:559; Interrogation_Position=921; Antisense; GGACAAGCGACATCACTTGGCAATT

Paste this into a BLAST search page for me
AAAGCTGTCGCTCAAATAACGGGATATCACATTTCTTTTAGCTTGGCCCATGGCCCAAGCCCACTTAATATACAAAAGGTCTCCGACGATGAAATGCATGAAATGCATGAGAATTCCACCACGGACAGACTTCCGCCGAGTACGTTTACGGAACAAAACGGACATTGACCCGCTTTTGACCCGCTTTACCTGCAATCTAATGCAATCTAACAAACGGGCCGCATTAGGAGACCACACTGCTTGACAAGATGAAATGGTGCACGATACCGCCAACAAACAGCGTTCAACTTGCACTCAATGGAATTTTTTGTCCTGTACAAGCAGAGGACAAGCGACATCACTTGGCAATT

Full Affymetrix probeset data:

Annotations for 1628096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720