Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628097_at:

>probe:Drosophila_2:1628097_at:168:339; Interrogation_Position=3644; Antisense; GCTCTAATAGTTGTCTGGTGTCGCA
>probe:Drosophila_2:1628097_at:351:101; Interrogation_Position=3668; Antisense; AGAGTACGGGCAACCTGACCACTAC
>probe:Drosophila_2:1628097_at:520:103; Interrogation_Position=3754; Antisense; AGAGCCTCCTGGAAGTTGCAACACT
>probe:Drosophila_2:1628097_at:296:375; Interrogation_Position=3797; Antisense; GAAGATTATCCGAAGCCACGGCTGA
>probe:Drosophila_2:1628097_at:425:209; Interrogation_Position=3838; Antisense; AAGACACCACTTCCTGTGGCGGGAG
>probe:Drosophila_2:1628097_at:724:387; Interrogation_Position=3886; Antisense; GAAAGTGTCGAGCTCCTGGGACCTC
>probe:Drosophila_2:1628097_at:697:285; Interrogation_Position=3901; Antisense; CTGGGACCTCGTCGGAACTCAAGAC
>probe:Drosophila_2:1628097_at:399:399; Interrogation_Position=3962; Antisense; GACAGGCTATGAATTTCCGCTTCTC
>probe:Drosophila_2:1628097_at:419:109; Interrogation_Position=4010; Antisense; AGAAGGGTCTGCGTGGACTGCCCTC
>probe:Drosophila_2:1628097_at:554:337; Interrogation_Position=4040; Antisense; GCTCCCTGCGAGATCCGAGTAGCAA
>probe:Drosophila_2:1628097_at:531:75; Interrogation_Position=4078; Antisense; AGGAGTCATTCGCATGCAAACCGCC
>probe:Drosophila_2:1628097_at:135:255; Interrogation_Position=4094; Antisense; CAAACCGCCGTTTCGTGATTTATGT
>probe:Drosophila_2:1628097_at:680:25; Interrogation_Position=4169; Antisense; ATACCCACACGAGTTTGGTTGTTCA
>probe:Drosophila_2:1628097_at:350:465; Interrogation_Position=4186; Antisense; GTTGTTCATTTGTATCCCCGTAGAA

Paste this into a BLAST search page for me
GCTCTAATAGTTGTCTGGTGTCGCAAGAGTACGGGCAACCTGACCACTACAGAGCCTCCTGGAAGTTGCAACACTGAAGATTATCCGAAGCCACGGCTGAAAGACACCACTTCCTGTGGCGGGAGGAAAGTGTCGAGCTCCTGGGACCTCCTGGGACCTCGTCGGAACTCAAGACGACAGGCTATGAATTTCCGCTTCTCAGAAGGGTCTGCGTGGACTGCCCTCGCTCCCTGCGAGATCCGAGTAGCAAAGGAGTCATTCGCATGCAAACCGCCCAAACCGCCGTTTCGTGATTTATGTATACCCACACGAGTTTGGTTGTTCAGTTGTTCATTTGTATCCCCGTAGAA

Full Affymetrix probeset data:

Annotations for 1628097_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime