FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628099_at:

>probe:Drosophila_2:1628099_at:616:99; Interrogation_Position=1869; Antisense; AGATGGCCTGGCTTTCGGATCAGGA
>probe:Drosophila_2:1628099_at:86:555; Interrogation_Position=1891; Antisense; GGAGCGTGCTGATCACAAATCCATC
>probe:Drosophila_2:1628099_at:523:213; Interrogation_Position=2039; Antisense; AAGTTGGTACGCACAGGGCTTTATC
>probe:Drosophila_2:1628099_at:367:571; Interrogation_Position=2055; Antisense; GGCTTTATCTTACTAACGACCACCA
>probe:Drosophila_2:1628099_at:443:127; Interrogation_Position=2080; Antisense; ACCAGCAGCCGAGACACCAAAATAG
>probe:Drosophila_2:1628099_at:271:243; Interrogation_Position=2100; Antisense; AATAGTGCATATCGGTTACGTGTAT
>probe:Drosophila_2:1628099_at:292:289; Interrogation_Position=2118; Antisense; CGTGTATGCATTTAACAGCCTGTAC
>probe:Drosophila_2:1628099_at:1:15; Interrogation_Position=2208; Antisense; ATTATAAGCCTACATCCACTGTCTC
>probe:Drosophila_2:1628099_at:646:193; Interrogation_Position=2264; Antisense; AACTGCTGTCGTTGCATTTCGTATG
>probe:Drosophila_2:1628099_at:185:163; Interrogation_Position=2312; Antisense; AAATTGAATTCGGTCGCGCCAGCAC
>probe:Drosophila_2:1628099_at:203:503; Interrogation_Position=2324; Antisense; GTCGCGCCAGCACTGTGAGAGATTT
>probe:Drosophila_2:1628099_at:124:687; Interrogation_Position=2348; Antisense; TATATTAAACTTCTCGCTGGCTCTT
>probe:Drosophila_2:1628099_at:698:125; Interrogation_Position=2375; Antisense; ACCAATTTCACTTGTCCGCAGTGTT
>probe:Drosophila_2:1628099_at:523:503; Interrogation_Position=2388; Antisense; GTCCGCAGTGTTTCCTATATGTGAG

Paste this into a BLAST search page for me
AGATGGCCTGGCTTTCGGATCAGGAGGAGCGTGCTGATCACAAATCCATCAAGTTGGTACGCACAGGGCTTTATCGGCTTTATCTTACTAACGACCACCAACCAGCAGCCGAGACACCAAAATAGAATAGTGCATATCGGTTACGTGTATCGTGTATGCATTTAACAGCCTGTACATTATAAGCCTACATCCACTGTCTCAACTGCTGTCGTTGCATTTCGTATGAAATTGAATTCGGTCGCGCCAGCACGTCGCGCCAGCACTGTGAGAGATTTTATATTAAACTTCTCGCTGGCTCTTACCAATTTCACTTGTCCGCAGTGTTGTCCGCAGTGTTTCCTATATGTGAG

Full Affymetrix probeset data:

Annotations for 1628099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720