FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628100_at:

>probe:Drosophila_2:1628100_at:348:725; Interrogation_Position=215; Antisense; TTGGTGGCGCCCTGTTCAAATTGCA
>probe:Drosophila_2:1628100_at:309:327; Interrogation_Position=270; Antisense; GCGTTACTTAACTTTGCCCAACAAT
>probe:Drosophila_2:1628100_at:283:429; Interrogation_Position=385; Antisense; GAGTTCTATCATTGCGATCCCATTA
>probe:Drosophila_2:1628100_at:359:529; Interrogation_Position=415; Antisense; GGGTTAGCTCGTGCCAAGGATCAAG
>probe:Drosophila_2:1628100_at:93:497; Interrogation_Position=439; Antisense; GTCATACCCCTCTATGTGGTCAAAA
>probe:Drosophila_2:1628100_at:558:1; Interrogation_Position=473; Antisense; ATATTCCCGGTCTGGTTGGACTATT
>probe:Drosophila_2:1628100_at:511:601; Interrogation_Position=498; Antisense; TGTAGCTGGAGTTTTCAGTGCCGCC
>probe:Drosophila_2:1628100_at:234:659; Interrogation_Position=524; Antisense; TAAGTTCACTTTCTACGGCTCTGAA
>probe:Drosophila_2:1628100_at:92:643; Interrogation_Position=543; Antisense; TCTGAACTCTCTTTCCGGAGTGATA
>probe:Drosophila_2:1628100_at:277:141; Interrogation_Position=612; Antisense; ACGGCAAACCGCCTATTTGTTGAGA
>probe:Drosophila_2:1628100_at:298:549; Interrogation_Position=637; Antisense; GGAGTGGTCATATCTTTTGGCCTGA
>probe:Drosophila_2:1628100_at:233:579; Interrogation_Position=669; Antisense; GGCCAGTGTACCGATTGTCCAGAGA
>probe:Drosophila_2:1628100_at:157:101; Interrogation_Position=689; Antisense; AGAGACTTGGCCTGGTCATGCAGCT
>probe:Drosophila_2:1628100_at:227:497; Interrogation_Position=703; Antisense; GTCATGCAGCTATCCTCAACAGTGG

Paste this into a BLAST search page for me
TTGGTGGCGCCCTGTTCAAATTGCAGCGTTACTTAACTTTGCCCAACAATGAGTTCTATCATTGCGATCCCATTAGGGTTAGCTCGTGCCAAGGATCAAGGTCATACCCCTCTATGTGGTCAAAAATATTCCCGGTCTGGTTGGACTATTTGTAGCTGGAGTTTTCAGTGCCGCCTAAGTTCACTTTCTACGGCTCTGAATCTGAACTCTCTTTCCGGAGTGATAACGGCAAACCGCCTATTTGTTGAGAGGAGTGGTCATATCTTTTGGCCTGAGGCCAGTGTACCGATTGTCCAGAGAAGAGACTTGGCCTGGTCATGCAGCTGTCATGCAGCTATCCTCAACAGTGG

Full Affymetrix probeset data:

Annotations for 1628100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720