Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628101_s_at:

>probe:Drosophila_2:1628101_s_at:208:505; Interrogation_Position=315; Antisense; GTCCAACAACGTGAGCTACGACAAG
>probe:Drosophila_2:1628101_s_at:302:161; Interrogation_Position=335; Antisense; ACAAGATAGCCTGGACTCGGGATAT
>probe:Drosophila_2:1628101_s_at:517:529; Interrogation_Position=353; Antisense; GGGATATCACAGAACCCTTGGCTGA
>probe:Drosophila_2:1628101_s_at:411:201; Interrogation_Position=365; Antisense; AACCCTTGGCTGAGGAGTCATCTAC
>probe:Drosophila_2:1628101_s_at:412:497; Interrogation_Position=381; Antisense; GTCATCTACAAGTCAATTGCGCCCG
>probe:Drosophila_2:1628101_s_at:218:333; Interrogation_Position=405; Antisense; GCTGGGTACCTCGATTCCAACCAAT
>probe:Drosophila_2:1628101_s_at:209:7; Interrogation_Position=418; Antisense; ATTCCAACCAATTCGACGGCATCGG
>probe:Drosophila_2:1628101_s_at:130:253; Interrogation_Position=456; Antisense; CAACACTTCGTATTCCTTTACTGGA
>probe:Drosophila_2:1628101_s_at:442:551; Interrogation_Position=478; Antisense; GGAGACTATCTATCTGGTGGCAATA
>probe:Drosophila_2:1628101_s_at:628:577; Interrogation_Position=504; Antisense; GGCCGATCTGAAGGGTGGCTATCCA
>probe:Drosophila_2:1628101_s_at:575:73; Interrogation_Position=578; Antisense; AGGAACATACCGCAGACGACTCACT
>probe:Drosophila_2:1628101_s_at:515:85; Interrogation_Position=608; Antisense; AGTGCAACATATGCCTGGACACCGC
>probe:Drosophila_2:1628101_s_at:693:333; Interrogation_Position=640; Antisense; GCTGTGGTCAGCATGTGCGGCCATC
>probe:Drosophila_2:1628101_s_at:152:177; Interrogation_Position=715; Antisense; AAACTCTGTCCCGTTTGTAAGGCTG

Paste this into a BLAST search page for me
GTCCAACAACGTGAGCTACGACAAGACAAGATAGCCTGGACTCGGGATATGGGATATCACAGAACCCTTGGCTGAAACCCTTGGCTGAGGAGTCATCTACGTCATCTACAAGTCAATTGCGCCCGGCTGGGTACCTCGATTCCAACCAATATTCCAACCAATTCGACGGCATCGGCAACACTTCGTATTCCTTTACTGGAGGAGACTATCTATCTGGTGGCAATAGGCCGATCTGAAGGGTGGCTATCCAAGGAACATACCGCAGACGACTCACTAGTGCAACATATGCCTGGACACCGCGCTGTGGTCAGCATGTGCGGCCATCAAACTCTGTCCCGTTTGTAAGGCTG

Full Affymetrix probeset data:

Annotations for 1628101_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime