FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628103_at:

>probe:Drosophila_2:1628103_at:478:611; Interrogation_Position=236; Antisense; TGACTGTCATCGAAACTGGCACACC
>probe:Drosophila_2:1628103_at:438:447; Interrogation_Position=262; Antisense; GATGCCAACGGATGCTACACGCAAA
>probe:Drosophila_2:1628103_at:517:259; Interrogation_Position=279; Antisense; CACGCAAACTATTCGGGAACCCAAT
>probe:Drosophila_2:1628103_at:21:235; Interrogation_Position=301; Antisense; AATCCCAGCAATCCAAAGTCCTATA
>probe:Drosophila_2:1628103_at:118:29; Interrogation_Position=323; Antisense; ATACGGAGACACAGCACCTGATCTG
>probe:Drosophila_2:1628103_at:167:237; Interrogation_Position=384; Antisense; AATCGCTCCAAGTATTGCCCAGGTT
>probe:Drosophila_2:1628103_at:78:599; Interrogation_Position=570; Antisense; TGTCGCCCCTGTAGTGGTTCATCCT
>probe:Drosophila_2:1628103_at:294:465; Interrogation_Position=654; Antisense; GATTGCTCCCGCAGTTCAGCAAAAT
>probe:Drosophila_2:1628103_at:359:357; Interrogation_Position=672; Antisense; GCAAAATCCTGGTCAGCCACAGGTT
>probe:Drosophila_2:1628103_at:69:155; Interrogation_Position=690; Antisense; ACAGGTTATCCTACTCTCAAAGAAA
>probe:Drosophila_2:1628103_at:354:255; Interrogation_Position=729; Antisense; CAAAAAGCGATCATCTGCACCCACA
>probe:Drosophila_2:1628103_at:373:633; Interrogation_Position=762; Antisense; TCCGCAGGGAGTGCTAGCCATGCTA
>probe:Drosophila_2:1628103_at:145:675; Interrogation_Position=776; Antisense; TAGCCATGCTAGTGATTTTCTACTC
>probe:Drosophila_2:1628103_at:81:699; Interrogation_Position=791; Antisense; TTTTCTACTCAATCAAGGCTTTTAC

Paste this into a BLAST search page for me
TGACTGTCATCGAAACTGGCACACCGATGCCAACGGATGCTACACGCAAACACGCAAACTATTCGGGAACCCAATAATCCCAGCAATCCAAAGTCCTATAATACGGAGACACAGCACCTGATCTGAATCGCTCCAAGTATTGCCCAGGTTTGTCGCCCCTGTAGTGGTTCATCCTGATTGCTCCCGCAGTTCAGCAAAATGCAAAATCCTGGTCAGCCACAGGTTACAGGTTATCCTACTCTCAAAGAAACAAAAAGCGATCATCTGCACCCACATCCGCAGGGAGTGCTAGCCATGCTATAGCCATGCTAGTGATTTTCTACTCTTTTCTACTCAATCAAGGCTTTTAC

Full Affymetrix probeset data:

Annotations for 1628103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720