FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628106_at:

>probe:Drosophila_2:1628106_at:37:89; Interrogation_Position=1139; Antisense; AGTCATCACAACACCAGCCGGAGAT
>probe:Drosophila_2:1628106_at:690:713; Interrogation_Position=1223; Antisense; TTCTTGAAGCTCTGGCGCTGTGCGA
>probe:Drosophila_2:1628106_at:231:639; Interrogation_Position=1316; Antisense; TCTTGGTCCTTCTGGTGGAGTTCAC
>probe:Drosophila_2:1628106_at:724:517; Interrogation_Position=1348; Antisense; GTGGGCATGCGCACTATCTTTCTGC
>probe:Drosophila_2:1628106_at:406:217; Interrogation_Position=1378; Antisense; AAGTTCATCGTGTTTGGCGTGATCC
>probe:Drosophila_2:1628106_at:387:513; Interrogation_Position=1396; Antisense; GTGATCCTGTTCTGCGTCTTCATGG
>probe:Drosophila_2:1628106_at:478:711; Interrogation_Position=1414; Antisense; TTCATGGCCTCCATCTGGAACTATA
>probe:Drosophila_2:1628106_at:562:429; Interrogation_Position=1507; Antisense; GAGTACTTCTACTGAGGCTGTGTAT
>probe:Drosophila_2:1628106_at:61:675; Interrogation_Position=1531; Antisense; TAGCAGCCAAGCTCAATGCGCATTT
>probe:Drosophila_2:1628106_at:3:477; Interrogation_Position=1604; Antisense; GTTATAGCGCTCTTACTTGATCTTT
>probe:Drosophila_2:1628106_at:603:443; Interrogation_Position=1622; Antisense; GATCTTTTTATTCGTGTAACCGTCA
>probe:Drosophila_2:1628106_at:133:131; Interrogation_Position=1640; Antisense; ACCGTCAATGCAATTCCATGGTCTC
>probe:Drosophila_2:1628106_at:356:269; Interrogation_Position=1656; Antisense; CATGGTCTCTTTCTGTGTAACGTCA
>probe:Drosophila_2:1628106_at:66:493; Interrogation_Position=1672; Antisense; GTAACGTCATCCATATCCCAGGAAT

Paste this into a BLAST search page for me
AGTCATCACAACACCAGCCGGAGATTTCTTGAAGCTCTGGCGCTGTGCGATCTTGGTCCTTCTGGTGGAGTTCACGTGGGCATGCGCACTATCTTTCTGCAAGTTCATCGTGTTTGGCGTGATCCGTGATCCTGTTCTGCGTCTTCATGGTTCATGGCCTCCATCTGGAACTATAGAGTACTTCTACTGAGGCTGTGTATTAGCAGCCAAGCTCAATGCGCATTTGTTATAGCGCTCTTACTTGATCTTTGATCTTTTTATTCGTGTAACCGTCAACCGTCAATGCAATTCCATGGTCTCCATGGTCTCTTTCTGTGTAACGTCAGTAACGTCATCCATATCCCAGGAAT

Full Affymetrix probeset data:

Annotations for 1628106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720