FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628107_at:

>probe:Drosophila_2:1628107_at:233:307; Interrogation_Position=107; Antisense; CCTCTTCGATGGTGGGCATGGCGCA
>probe:Drosophila_2:1628107_at:484:441; Interrogation_Position=133; Antisense; GATGGAGCTGCCTGCATGGCTTTTA
>probe:Drosophila_2:1628107_at:500:699; Interrogation_Position=154; Antisense; TTTATGCCGGCCTGGACCTATGATG
>probe:Drosophila_2:1628107_at:528:217; Interrogation_Position=16; Antisense; AAGTATATCGGCTTTGTCGCCATCG
>probe:Drosophila_2:1628107_at:174:683; Interrogation_Position=172; Antisense; TATGATGCCTCCAAAAACGCCTGCA
>probe:Drosophila_2:1628107_at:118:181; Interrogation_Position=185; Antisense; AAAACGCCTGCACCGAGTTCATTTT
>probe:Drosophila_2:1628107_at:609:639; Interrogation_Position=209; Antisense; TCGGTGGCTGCGGTGGAAACTCCAA
>probe:Drosophila_2:1628107_at:113:391; Interrogation_Position=224; Antisense; GAAACTCCAATCAGTTCTCTACCAA
>probe:Drosophila_2:1628107_at:488:49; Interrogation_Position=255; Antisense; ATGCGAAAAGGCCTGCAAGGACTAA
>probe:Drosophila_2:1628107_at:673:313; Interrogation_Position=34; Antisense; GCCATCGCCTTTTTGCTGAGTCTGT
>probe:Drosophila_2:1628107_at:643:699; Interrogation_Position=43; Antisense; TTTTTGCTGAGTCTGTCCGGCAGTC
>probe:Drosophila_2:1628107_at:225:505; Interrogation_Position=57; Antisense; GTCCGGCAGTCGTTTATGGGTGCAT
>probe:Drosophila_2:1628107_at:457:705; Interrogation_Position=70; Antisense; TTATGGGTGCATGCCAAGCCGGAGA
>probe:Drosophila_2:1628107_at:653:203; Interrogation_Position=85; Antisense; AAGCCGGAGATGTGCCAGCAGCCCT

Paste this into a BLAST search page for me
CCTCTTCGATGGTGGGCATGGCGCAGATGGAGCTGCCTGCATGGCTTTTATTTATGCCGGCCTGGACCTATGATGAAGTATATCGGCTTTGTCGCCATCGTATGATGCCTCCAAAAACGCCTGCAAAAACGCCTGCACCGAGTTCATTTTTCGGTGGCTGCGGTGGAAACTCCAAGAAACTCCAATCAGTTCTCTACCAAATGCGAAAAGGCCTGCAAGGACTAAGCCATCGCCTTTTTGCTGAGTCTGTTTTTTGCTGAGTCTGTCCGGCAGTCGTCCGGCAGTCGTTTATGGGTGCATTTATGGGTGCATGCCAAGCCGGAGAAAGCCGGAGATGTGCCAGCAGCCCT

Full Affymetrix probeset data:

Annotations for 1628107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720