Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628109_at:

>probe:Drosophila_2:1628109_at:376:687; Interrogation_Position=3875; Antisense; TATATTATAAACAGCGGACGGACAT
>probe:Drosophila_2:1628109_at:554:259; Interrogation_Position=3886; Antisense; CAGCGGACGGACATACATAAATACA
>probe:Drosophila_2:1628109_at:42:257; Interrogation_Position=3909; Antisense; CAAACGGCAGATGTATCTATGTAAT
>probe:Drosophila_2:1628109_at:393:243; Interrogation_Position=3959; Antisense; AATTGTAAAATGCTCGCCCAACTCT
>probe:Drosophila_2:1628109_at:375:321; Interrogation_Position=3974; Antisense; GCCCAACTCTCGAAGGGATTGCGAA
>probe:Drosophila_2:1628109_at:161:93; Interrogation_Position=3998; Antisense; AGTTCCGGGCGGTCGAGGTATATCA
>probe:Drosophila_2:1628109_at:55:663; Interrogation_Position=4039; Antisense; TAAATGCGTTGGAATACATAGCCCC
>probe:Drosophila_2:1628109_at:513:663; Interrogation_Position=4111; Antisense; TAAATTGCTATTATCGTAGTCGATT
>probe:Drosophila_2:1628109_at:172:661; Interrogation_Position=4144; Antisense; TAAAACCGGGCGTACATGTGCCTAC
>probe:Drosophila_2:1628109_at:353:667; Interrogation_Position=4156; Antisense; TACATGTGCCTACGCCCGCGTGGAG
>probe:Drosophila_2:1628109_at:361:321; Interrogation_Position=4169; Antisense; GCCCGCGTGGAGGACTAGCCAGTAA
>probe:Drosophila_2:1628109_at:595:313; Interrogation_Position=4186; Antisense; GCCAGTAAGTTAGTCGAGTGTATAT
>probe:Drosophila_2:1628109_at:469:433; Interrogation_Position=4201; Antisense; GAGTGTATATCTAAGTGATCCCAAT
>probe:Drosophila_2:1628109_at:460:449; Interrogation_Position=4217; Antisense; GATCCCAATTCAAAGCATACAAATA

Paste this into a BLAST search page for me
TATATTATAAACAGCGGACGGACATCAGCGGACGGACATACATAAATACACAAACGGCAGATGTATCTATGTAATAATTGTAAAATGCTCGCCCAACTCTGCCCAACTCTCGAAGGGATTGCGAAAGTTCCGGGCGGTCGAGGTATATCATAAATGCGTTGGAATACATAGCCCCTAAATTGCTATTATCGTAGTCGATTTAAAACCGGGCGTACATGTGCCTACTACATGTGCCTACGCCCGCGTGGAGGCCCGCGTGGAGGACTAGCCAGTAAGCCAGTAAGTTAGTCGAGTGTATATGAGTGTATATCTAAGTGATCCCAATGATCCCAATTCAAAGCATACAAATA

Full Affymetrix probeset data:

Annotations for 1628109_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime