FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628111_at:

>probe:Drosophila_2:1628111_at:375:665; Interrogation_Position=102; Antisense; TACAATGAGTGTGCCCAAGTGCTTG
>probe:Drosophila_2:1628111_at:80:221; Interrogation_Position=118; Antisense; AAGTGCTTGACCAGATGGTGCCCAT
>probe:Drosophila_2:1628111_at:122:507; Interrogation_Position=135; Antisense; GTGCCCATTGCGGATATGCTAGCGT
>probe:Drosophila_2:1628111_at:708:555; Interrogation_Position=197; Antisense; GGACGACTATCCCAAACAGATCTGC
>probe:Drosophila_2:1628111_at:527:97; Interrogation_Position=214; Antisense; AGATCTGCCGCATCTGCGTGAAGAA
>probe:Drosophila_2:1628111_at:647:597; Interrogation_Position=241; Antisense; TGTCGATGGCCTACGAGTTCAGCCA
>probe:Drosophila_2:1628111_at:543:309; Interrogation_Position=286; Antisense; GCGAGTTCAACGTGGCCCTAAAGTT
>probe:Drosophila_2:1628111_at:20:357; Interrogation_Position=359; Antisense; GCAAACCCAAACTCATCCGGTGGAA
>probe:Drosophila_2:1628111_at:113:211; Interrogation_Position=387; Antisense; AAGAATGAGCAACTGCCCACGGTGC
>probe:Drosophila_2:1628111_at:704:515; Interrogation_Position=423; Antisense; GTGTCGACCAAAAGAGCTGCTACTC
>probe:Drosophila_2:1628111_at:387:571; Interrogation_Position=492; Antisense; GGCTTCTGCGGCGAATGTTTTTACA
>probe:Drosophila_2:1628111_at:463:551; Interrogation_Position=518; Antisense; GGAGAAGGCCTGCAAATTTCACTTA
>probe:Drosophila_2:1628111_at:181:217; Interrogation_Position=543; Antisense; AAGTTCTCGCACAAGGATCTTTAGA
>probe:Drosophila_2:1628111_at:222:235; Interrogation_Position=79; Antisense; AATGCCTGGAATCGCTGTCCATTTA

Paste this into a BLAST search page for me
TACAATGAGTGTGCCCAAGTGCTTGAAGTGCTTGACCAGATGGTGCCCATGTGCCCATTGCGGATATGCTAGCGTGGACGACTATCCCAAACAGATCTGCAGATCTGCCGCATCTGCGTGAAGAATGTCGATGGCCTACGAGTTCAGCCAGCGAGTTCAACGTGGCCCTAAAGTTGCAAACCCAAACTCATCCGGTGGAAAAGAATGAGCAACTGCCCACGGTGCGTGTCGACCAAAAGAGCTGCTACTCGGCTTCTGCGGCGAATGTTTTTACAGGAGAAGGCCTGCAAATTTCACTTAAAGTTCTCGCACAAGGATCTTTAGAAATGCCTGGAATCGCTGTCCATTTA

Full Affymetrix probeset data:

Annotations for 1628111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720