FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628112_at:

>probe:Drosophila_2:1628112_at:472:539; Interrogation_Position=3333; Antisense; GGTTAAGAACGAACGCTCCTCGCGA
>probe:Drosophila_2:1628112_at:522:293; Interrogation_Position=3355; Antisense; CGATTCGTTGCGTGTTGCCAGCACA
>probe:Drosophila_2:1628112_at:143:113; Interrogation_Position=3374; Antisense; AGCACATATCGGACGCCATTGACGG
>probe:Drosophila_2:1628112_at:77:685; Interrogation_Position=3441; Antisense; TATCGGTCCCGACAATCCTGAGGAA
>probe:Drosophila_2:1628112_at:279:191; Interrogation_Position=3484; Antisense; AACTATAATTGTGTGGCGCCAGGCA
>probe:Drosophila_2:1628112_at:203:135; Interrogation_Position=3510; Antisense; ACGTTTCCAACCCATGAACAACTTG
>probe:Drosophila_2:1628112_at:43:319; Interrogation_Position=3600; Antisense; GCCGTTCTTTGTCCTTGACGAGATT
>probe:Drosophila_2:1628112_at:410:49; Interrogation_Position=3626; Antisense; ATGCCGCCTTGGACAACACGAATAT
>probe:Drosophila_2:1628112_at:274:365; Interrogation_Position=3645; Antisense; GAATATTGGCAAAGTCGCTTCGTAT
>probe:Drosophila_2:1628112_at:333:175; Interrogation_Position=3695; Antisense; AAACCATCGTCATTTCCCTGAAGGA
>probe:Drosophila_2:1628112_at:126:93; Interrogation_Position=3722; Antisense; AGTTCTATGGTCATGCTGATGCTCT
>probe:Drosophila_2:1628112_at:688:605; Interrogation_Position=3738; Antisense; TGATGCTCTTGTGGGCATTACGCCT
>probe:Drosophila_2:1628112_at:392:563; Interrogation_Position=3765; Antisense; GGAAGGCGACTGTCTCGTATCAAAT
>probe:Drosophila_2:1628112_at:460:585; Interrogation_Position=3800; Antisense; TGGACTTGACAACGTTCGAGGACAC

Paste this into a BLAST search page for me
GGTTAAGAACGAACGCTCCTCGCGACGATTCGTTGCGTGTTGCCAGCACAAGCACATATCGGACGCCATTGACGGTATCGGTCCCGACAATCCTGAGGAAAACTATAATTGTGTGGCGCCAGGCAACGTTTCCAACCCATGAACAACTTGGCCGTTCTTTGTCCTTGACGAGATTATGCCGCCTTGGACAACACGAATATGAATATTGGCAAAGTCGCTTCGTATAAACCATCGTCATTTCCCTGAAGGAAGTTCTATGGTCATGCTGATGCTCTTGATGCTCTTGTGGGCATTACGCCTGGAAGGCGACTGTCTCGTATCAAATTGGACTTGACAACGTTCGAGGACAC

Full Affymetrix probeset data:

Annotations for 1628112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720