FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628113_at:

>probe:Drosophila_2:1628113_at:115:575; Interrogation_Position=1023; Antisense; GGCGGCCCAGACCATAGCCAATGAA
>probe:Drosophila_2:1628113_at:52:675; Interrogation_Position=1037; Antisense; TAGCCAATGAATACCGGGCCCTGAA
>probe:Drosophila_2:1628113_at:431:419; Interrogation_Position=1102; Antisense; GAGCATCTTTACGAGCGGTTCGATC
>probe:Drosophila_2:1628113_at:524:541; Interrogation_Position=1118; Antisense; GGTTCGATCACTACGAGTATCCGGA
>probe:Drosophila_2:1628113_at:211:91; Interrogation_Position=1133; Antisense; AGTATCCGGACACTCACACCATGAG
>probe:Drosophila_2:1628113_at:98:119; Interrogation_Position=1160; Antisense; AGCTGAAGCAGGCTGCGTCCTTGAA
>probe:Drosophila_2:1628113_at:96:559; Interrogation_Position=1231; Antisense; GGAAAACCGCATGTGGTCTACGTAT
>probe:Drosophila_2:1628113_at:189:621; Interrogation_Position=686; Antisense; TGCTGTACTACCTGCGCTTTGTCAA
>probe:Drosophila_2:1628113_at:408:623; Interrogation_Position=746; Antisense; TGCGGACCAGCAAGAGCATCATCAA
>probe:Drosophila_2:1628113_at:132:347; Interrogation_Position=761; Antisense; GCATCATCAACGTTCACGATCGCAT
>probe:Drosophila_2:1628113_at:268:451; Interrogation_Position=778; Antisense; GATCGCATCCTGCAGGGTCACAATC
>probe:Drosophila_2:1628113_at:516:301; Interrogation_Position=833; Antisense; CCCTGGGTGGCGGTAATCATGTTAA
>probe:Drosophila_2:1628113_at:35:543; Interrogation_Position=859; Antisense; GGATTGGGCATGACCCTCAATTATC
>probe:Drosophila_2:1628113_at:320:105; Interrogation_Position=977; Antisense; AGACGACTCTGCCACAACTGGACAA

Paste this into a BLAST search page for me
GGCGGCCCAGACCATAGCCAATGAATAGCCAATGAATACCGGGCCCTGAAGAGCATCTTTACGAGCGGTTCGATCGGTTCGATCACTACGAGTATCCGGAAGTATCCGGACACTCACACCATGAGAGCTGAAGCAGGCTGCGTCCTTGAAGGAAAACCGCATGTGGTCTACGTATTGCTGTACTACCTGCGCTTTGTCAATGCGGACCAGCAAGAGCATCATCAAGCATCATCAACGTTCACGATCGCATGATCGCATCCTGCAGGGTCACAATCCCCTGGGTGGCGGTAATCATGTTAAGGATTGGGCATGACCCTCAATTATCAGACGACTCTGCCACAACTGGACAA

Full Affymetrix probeset data:

Annotations for 1628113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720