FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628115_at:

>probe:Drosophila_2:1628115_at:597:561; Interrogation_Position=1176; Antisense; GGAACAGCGGCTTCAAAACCATCAA
>probe:Drosophila_2:1628115_at:35:657; Interrogation_Position=1203; Antisense; TAATGTTCAGTTTAAGCGGCAGCAA
>probe:Drosophila_2:1628115_at:472:507; Interrogation_Position=1247; Antisense; GGATAAGGAAACTCCGCCAGGATCT
>probe:Drosophila_2:1628115_at:117:437; Interrogation_Position=1300; Antisense; GAGGAGACCCGTCCAGGTACCAACT
>probe:Drosophila_2:1628115_at:536:437; Interrogation_Position=1345; Antisense; GAGGAACTCCGCGAGGATGCCTTCT
>probe:Drosophila_2:1628115_at:14:435; Interrogation_Position=1357; Antisense; GAGGATGCCTTCTTCTTCGATTACG
>probe:Drosophila_2:1628115_at:204:707; Interrogation_Position=1377; Antisense; TTACGCCCGTCAGCTGATGGATGAA
>probe:Drosophila_2:1628115_at:497:205; Interrogation_Position=1400; Antisense; AAGCCCAAGCCAAGGGATGTCCGCT
>probe:Drosophila_2:1628115_at:581:529; Interrogation_Position=1413; Antisense; GGGATGTCCGCTAAAACCATTTATT
>probe:Drosophila_2:1628115_at:622:701; Interrogation_Position=1433; Antisense; TTATTCGCGCTGTGGGTCAGTACAA
>probe:Drosophila_2:1628115_at:317:671; Interrogation_Position=1484; Antisense; TACGGATTCCTCGTCACATGATCAC
>probe:Drosophila_2:1628115_at:168:59; Interrogation_Position=1501; Antisense; ATGATCACTCGATTGCCCATGGGCA
>probe:Drosophila_2:1628115_at:479:345; Interrogation_Position=1582; Antisense; GAACCCAATTCCGAGAAGTTGAGCA
>probe:Drosophila_2:1628115_at:74:237; Interrogation_Position=1653; Antisense; AATCGAGGCGTTAGTTTTACAGGAG

Paste this into a BLAST search page for me
GGAACAGCGGCTTCAAAACCATCAATAATGTTCAGTTTAAGCGGCAGCAAGGATAAGGAAACTCCGCCAGGATCTGAGGAGACCCGTCCAGGTACCAACTGAGGAACTCCGCGAGGATGCCTTCTGAGGATGCCTTCTTCTTCGATTACGTTACGCCCGTCAGCTGATGGATGAAAAGCCCAAGCCAAGGGATGTCCGCTGGGATGTCCGCTAAAACCATTTATTTTATTCGCGCTGTGGGTCAGTACAATACGGATTCCTCGTCACATGATCACATGATCACTCGATTGCCCATGGGCAGAACCCAATTCCGAGAAGTTGAGCAAATCGAGGCGTTAGTTTTACAGGAG

Full Affymetrix probeset data:

Annotations for 1628115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720