FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628116_at:

>probe:Drosophila_2:1628116_at:639:59; Interrogation_Position=121; Antisense; ATGTTCCAGATCATCGGGCTGGTGA
>probe:Drosophila_2:1628116_at:316:613; Interrogation_Position=143; Antisense; TGAAGAGTGCCCGTTACTGCGAGCT
>probe:Drosophila_2:1628116_at:318:669; Interrogation_Position=157; Antisense; TACTGCGAGCTCTACGGAGACGATC
>probe:Drosophila_2:1628116_at:717:307; Interrogation_Position=186; Antisense; CCATCCGCTGGCCATGAGAAGCAAT
>probe:Drosophila_2:1628116_at:225:139; Interrogation_Position=239; Antisense; ACGTCCTGCGAATGCACGACATGCA
>probe:Drosophila_2:1628116_at:173:377; Interrogation_Position=27; Antisense; GAAGCAGATTAACTTGGGCCTTCTT
>probe:Drosophila_2:1628116_at:126:207; Interrogation_Position=286; Antisense; AAGCGACTGAGCAAGCTGGGCCTGT
>probe:Drosophila_2:1628116_at:51:535; Interrogation_Position=348; Antisense; GGTGCAGGCAGCTTATCCGCAGCCA
>probe:Drosophila_2:1628116_at:185:617; Interrogation_Position=392; Antisense; TGCAGGCACTGAGCACCGGTGATGA
>probe:Drosophila_2:1628116_at:401:533; Interrogation_Position=409; Antisense; GGTGATGACCACCAGCCGGATCCGT
>probe:Drosophila_2:1628116_at:280:199; Interrogation_Position=457; Antisense; AACGAGCTACTCAACGGTGTGGGCG
>probe:Drosophila_2:1628116_at:78:513; Interrogation_Position=500; Antisense; GTGAGCTGAATCGACGCTACGCGGA
>probe:Drosophila_2:1628116_at:682:685; Interrogation_Position=51; Antisense; TATCATTCTCACTCTATTGGGCTGT
>probe:Drosophila_2:1628116_at:492:671; Interrogation_Position=517; Antisense; TACGCGGAGAACCAGTTGCATCGAT

Paste this into a BLAST search page for me
ATGTTCCAGATCATCGGGCTGGTGATGAAGAGTGCCCGTTACTGCGAGCTTACTGCGAGCTCTACGGAGACGATCCCATCCGCTGGCCATGAGAAGCAATACGTCCTGCGAATGCACGACATGCAGAAGCAGATTAACTTGGGCCTTCTTAAGCGACTGAGCAAGCTGGGCCTGTGGTGCAGGCAGCTTATCCGCAGCCATGCAGGCACTGAGCACCGGTGATGAGGTGATGACCACCAGCCGGATCCGTAACGAGCTACTCAACGGTGTGGGCGGTGAGCTGAATCGACGCTACGCGGATATCATTCTCACTCTATTGGGCTGTTACGCGGAGAACCAGTTGCATCGAT

Full Affymetrix probeset data:

Annotations for 1628116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720