FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628117_at:

>probe:Drosophila_2:1628117_at:52:641; Interrogation_Position=1096; Antisense; TAGGCTAAACAACTGGAGGATTCAT
>probe:Drosophila_2:1628117_at:5:437; Interrogation_Position=1111; Antisense; GAGGATTCATTGCTCCCTTTGAGTT
>probe:Drosophila_2:1628117_at:71:337; Interrogation_Position=1122; Antisense; GCTCCCTTTGAGTTTATACTTTTTG
>probe:Drosophila_2:1628117_at:72:493; Interrogation_Position=1146; Antisense; GTAACAAGAACAGGCGCAACACTCG
>probe:Drosophila_2:1628117_at:665:187; Interrogation_Position=1163; Antisense; AACACTCGGGAGAATTTTGCATTTC
>probe:Drosophila_2:1628117_at:180:561; Interrogation_Position=637; Antisense; GGAACAGGCCAAGTCGGAGCGCATT
>probe:Drosophila_2:1628117_at:430:417; Interrogation_Position=653; Antisense; GAGCGCATTGTCCAGATCCAGCAAA
>probe:Drosophila_2:1628117_at:47:523; Interrogation_Position=680; Antisense; GGGCCTGCCCATTTGAGCGTCAAGG
>probe:Drosophila_2:1628117_at:131:21; Interrogation_Position=690; Antisense; ATTTGAGCGTCAAGGCACCGGCACC
>probe:Drosophila_2:1628117_at:629:375; Interrogation_Position=858; Antisense; GAAGACGACGAGATTCGCTGGCGAA
>probe:Drosophila_2:1628117_at:462:9; Interrogation_Position=870; Antisense; ATTCGCTGGCGAAGCACGAGAGAAA
>probe:Drosophila_2:1628117_at:410:177; Interrogation_Position=912; Antisense; AAACGGGAGTGTTGCCGCGCTGCTC
>probe:Drosophila_2:1628117_at:143:15; Interrogation_Position=982; Antisense; ATTACATTCACACACATCACATCAT
>probe:Drosophila_2:1628117_at:24:159; Interrogation_Position=991; Antisense; ACACACATCACATCATTACATCATC

Paste this into a BLAST search page for me
TAGGCTAAACAACTGGAGGATTCATGAGGATTCATTGCTCCCTTTGAGTTGCTCCCTTTGAGTTTATACTTTTTGGTAACAAGAACAGGCGCAACACTCGAACACTCGGGAGAATTTTGCATTTCGGAACAGGCCAAGTCGGAGCGCATTGAGCGCATTGTCCAGATCCAGCAAAGGGCCTGCCCATTTGAGCGTCAAGGATTTGAGCGTCAAGGCACCGGCACCGAAGACGACGAGATTCGCTGGCGAAATTCGCTGGCGAAGCACGAGAGAAAAAACGGGAGTGTTGCCGCGCTGCTCATTACATTCACACACATCACATCATACACACATCACATCATTACATCATC

Full Affymetrix probeset data:

Annotations for 1628117_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720