FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628121_at:

>probe:Drosophila_2:1628121_at:183:245; Interrogation_Position=1023; Antisense; AATTTATTGACACACCACGCACACA
>probe:Drosophila_2:1628121_at:544:151; Interrogation_Position=1045; Antisense; ACATCACCCGCAAGTCAAGTCGAAT
>probe:Drosophila_2:1628121_at:304:661; Interrogation_Position=1077; Antisense; TAAAACCAAGAGTATTGCACCCGAA
>probe:Drosophila_2:1628121_at:597:159; Interrogation_Position=517; Antisense; ACAACCTGGAGTTCAAGCTGCCCGC
>probe:Drosophila_2:1628121_at:386:507; Interrogation_Position=565; Antisense; GTGCCCTCGATGAAGGCCGTGGCAA
>probe:Drosophila_2:1628121_at:333:653; Interrogation_Position=592; Antisense; TCAAGAAGATGCTGGGACCCGTGGC
>probe:Drosophila_2:1628121_at:521:621; Interrogation_Position=676; Antisense; TGCTGACCTTCAAGGCCGTGATCGT
>probe:Drosophila_2:1628121_at:411:541; Interrogation_Position=756; Antisense; GGATTCGGCAACAAGTTCGGAGGTA
>probe:Drosophila_2:1628121_at:223:713; Interrogation_Position=771; Antisense; TTCGGAGGTAACTCCTTTGCCGGAG
>probe:Drosophila_2:1628121_at:39:555; Interrogation_Position=792; Antisense; GGAGCCTACAACTCGAACGCATGGT
>probe:Drosophila_2:1628121_at:363:35; Interrogation_Position=879; Antisense; ATCAGCGAGGATGGGTCCGATGCCC
>probe:Drosophila_2:1628121_at:47:425; Interrogation_Position=949; Antisense; GAGACAGCTCAAACAGATGTGCCTT
>probe:Drosophila_2:1628121_at:295:97; Interrogation_Position=963; Antisense; AGATGTGCCTTCGTTTTGAAACCTT
>probe:Drosophila_2:1628121_at:530:721; Interrogation_Position=978; Antisense; TTGAAACCTTTAGCCTGTAGTAATT

Paste this into a BLAST search page for me
AATTTATTGACACACCACGCACACAACATCACCCGCAAGTCAAGTCGAATTAAAACCAAGAGTATTGCACCCGAAACAACCTGGAGTTCAAGCTGCCCGCGTGCCCTCGATGAAGGCCGTGGCAATCAAGAAGATGCTGGGACCCGTGGCTGCTGACCTTCAAGGCCGTGATCGTGGATTCGGCAACAAGTTCGGAGGTATTCGGAGGTAACTCCTTTGCCGGAGGGAGCCTACAACTCGAACGCATGGTATCAGCGAGGATGGGTCCGATGCCCGAGACAGCTCAAACAGATGTGCCTTAGATGTGCCTTCGTTTTGAAACCTTTTGAAACCTTTAGCCTGTAGTAATT

Full Affymetrix probeset data:

Annotations for 1628121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720