FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628122_at:

>probe:Drosophila_2:1628122_at:203:709; Interrogation_Position=1167; Antisense; TTAAGCGTGCCCGATTTGAACCAAG
>probe:Drosophila_2:1628122_at:695:457; Interrogation_Position=1179; Antisense; GATTTGAACCAAGCCGCCGAAATTC
>probe:Drosophila_2:1628122_at:677:641; Interrogation_Position=1202; Antisense; TCTTCGTAAACTCCATTAATCCCTT
>probe:Drosophila_2:1628122_at:392:613; Interrogation_Position=733; Antisense; TGAAGCCCAGTTCCAATCCACTGAG
>probe:Drosophila_2:1628122_at:429:49; Interrogation_Position=748; Antisense; ATCCACTGAGGACGCAGCTGGTGCA
>probe:Drosophila_2:1628122_at:208:121; Interrogation_Position=763; Antisense; AGCTGGTGCAGATCATGCGGCAGAA
>probe:Drosophila_2:1628122_at:705:623; Interrogation_Position=820; Antisense; TGCGCGTAATCCTGAGCAGCGGACA
>probe:Drosophila_2:1628122_at:483:353; Interrogation_Position=835; Antisense; GCAGCGGACATGTGATCTACCAGCG
>probe:Drosophila_2:1628122_at:315:453; Interrogation_Position=848; Antisense; GATCTACCAGCGGACGGCCAAGGAT
>probe:Drosophila_2:1628122_at:27:451; Interrogation_Position=870; Antisense; GATCGCGGCCAGAGTGGCTACCTTG
>probe:Drosophila_2:1628122_at:50:571; Interrogation_Position=885; Antisense; GGCTACCTTGCCATGAGAATTCAGT
>probe:Drosophila_2:1628122_at:325:13; Interrogation_Position=903; Antisense; ATTCAGTCGGGCAGGTACTTCAACA
>probe:Drosophila_2:1628122_at:242:539; Interrogation_Position=916; Antisense; GGTACTTCAACATCTACTACAGTGT
>probe:Drosophila_2:1628122_at:426:129; Interrogation_Position=990; Antisense; ACCTCCGATTTTGACGACGAGCTGA

Paste this into a BLAST search page for me
TTAAGCGTGCCCGATTTGAACCAAGGATTTGAACCAAGCCGCCGAAATTCTCTTCGTAAACTCCATTAATCCCTTTGAAGCCCAGTTCCAATCCACTGAGATCCACTGAGGACGCAGCTGGTGCAAGCTGGTGCAGATCATGCGGCAGAATGCGCGTAATCCTGAGCAGCGGACAGCAGCGGACATGTGATCTACCAGCGGATCTACCAGCGGACGGCCAAGGATGATCGCGGCCAGAGTGGCTACCTTGGGCTACCTTGCCATGAGAATTCAGTATTCAGTCGGGCAGGTACTTCAACAGGTACTTCAACATCTACTACAGTGTACCTCCGATTTTGACGACGAGCTGA

Full Affymetrix probeset data:

Annotations for 1628122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720