FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628124_at:

>probe:Drosophila_2:1628124_at:52:219; Interrogation_Position=1013; Antisense; AAGTACCACACTTTGCAGCAGCACG
>probe:Drosophila_2:1628124_at:507:375; Interrogation_Position=1046; Antisense; GAAGAGTTGCCCCACGAATGCCAGG
>probe:Drosophila_2:1628124_at:523:233; Interrogation_Position=1062; Antisense; AATGCCAGGTCTGTGGACGCCGGAT
>probe:Drosophila_2:1628124_at:27:271; Interrogation_Position=1114; Antisense; CATGCTGATGCACTCGAACGACAAG
>probe:Drosophila_2:1628124_at:226:695; Interrogation_Position=1166; Antisense; TTTGCCAGGCGATTCGAGCTCGAAG
>probe:Drosophila_2:1628124_at:504:379; Interrogation_Position=1187; Antisense; GAAGCCCATGTGAGAGCAGTCCACT
>probe:Drosophila_2:1628124_at:228:599; Interrogation_Position=1232; Antisense; TGTCACCACTGTCCGGAGAGCTTTG
>probe:Drosophila_2:1628124_at:524:401; Interrogation_Position=1249; Antisense; GAGCTTTGCTTCTAGGAAAACCCTG
>probe:Drosophila_2:1628124_at:328:609; Interrogation_Position=1300; Antisense; TGAGAAGCCCTACATTTGCGACACC
>probe:Drosophila_2:1628124_at:199:91; Interrogation_Position=1383; Antisense; AGTAGTCTTAGCTAGCCTTAGTGGA
>probe:Drosophila_2:1628124_at:540:415; Interrogation_Position=864; Antisense; GAGCCAGCTTTAACCAGTCGGCGAA
>probe:Drosophila_2:1628124_at:314:495; Interrogation_Position=880; Antisense; GTCGGCGAATCTTAAATACCACCTT
>probe:Drosophila_2:1628124_at:182:425; Interrogation_Position=957; Antisense; GAGAGCGCCATTTCTGCGACATTTG
>probe:Drosophila_2:1628124_at:111:225; Interrogation_Position=986; Antisense; AAGGAGTTCCATTCACGATACACCC

Paste this into a BLAST search page for me
AAGTACCACACTTTGCAGCAGCACGGAAGAGTTGCCCCACGAATGCCAGGAATGCCAGGTCTGTGGACGCCGGATCATGCTGATGCACTCGAACGACAAGTTTGCCAGGCGATTCGAGCTCGAAGGAAGCCCATGTGAGAGCAGTCCACTTGTCACCACTGTCCGGAGAGCTTTGGAGCTTTGCTTCTAGGAAAACCCTGTGAGAAGCCCTACATTTGCGACACCAGTAGTCTTAGCTAGCCTTAGTGGAGAGCCAGCTTTAACCAGTCGGCGAAGTCGGCGAATCTTAAATACCACCTTGAGAGCGCCATTTCTGCGACATTTGAAGGAGTTCCATTCACGATACACCC

Full Affymetrix probeset data:

Annotations for 1628124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720