FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628125_at:

>probe:Drosophila_2:1628125_at:77:75; Interrogation_Position=1397; Antisense; AGGAGTGCCTCCAGCGTTTTTATGC
>probe:Drosophila_2:1628125_at:405:475; Interrogation_Position=1412; Antisense; GTTTTTATGCAGCACTTTCAGCAGA
>probe:Drosophila_2:1628125_at:136:25; Interrogation_Position=1437; Antisense; ATATGCAGAGCCTGCTGAGGCCATC
>probe:Drosophila_2:1628125_at:295:45; Interrogation_Position=1459; Antisense; ATCGCTTGTGGATTTGGCATGTACC
>probe:Drosophila_2:1628125_at:286:59; Interrogation_Position=1477; Antisense; ATGTACCTACTTTGGGAGACCCCAT
>probe:Drosophila_2:1628125_at:667:121; Interrogation_Position=1513; Antisense; AGCGATTCAGGCCTCACCTATGTAT
>probe:Drosophila_2:1628125_at:688:483; Interrogation_Position=1534; Antisense; GTATCCACCAGCAGCGATGCTACAG
>probe:Drosophila_2:1628125_at:708:337; Interrogation_Position=1552; Antisense; GCTACAGGCGGGTTTGGGCCCACAT
>probe:Drosophila_2:1628125_at:77:577; Interrogation_Position=1607; Antisense; GGCGCGGATCTCATTTCCGATGAGT
>probe:Drosophila_2:1628125_at:36:177; Interrogation_Position=1668; Antisense; AAACGAGCACGTTGGAGCAGTCTAC
>probe:Drosophila_2:1628125_at:249:115; Interrogation_Position=1683; Antisense; AGCAGTCTACGCAGGAACAGCCACT
>probe:Drosophila_2:1628125_at:469:383; Interrogation_Position=1697; Antisense; GAACAGCCACTGGAACAACCATCTA
>probe:Drosophila_2:1628125_at:448:343; Interrogation_Position=1734; Antisense; GCTTCAGCATATCGGCCATTTTGGG
>probe:Drosophila_2:1628125_at:729:461; Interrogation_Position=1882; Antisense; GATTCTAGCCTGATTAGTACCTAAG

Paste this into a BLAST search page for me
AGGAGTGCCTCCAGCGTTTTTATGCGTTTTTATGCAGCACTTTCAGCAGAATATGCAGAGCCTGCTGAGGCCATCATCGCTTGTGGATTTGGCATGTACCATGTACCTACTTTGGGAGACCCCATAGCGATTCAGGCCTCACCTATGTATGTATCCACCAGCAGCGATGCTACAGGCTACAGGCGGGTTTGGGCCCACATGGCGCGGATCTCATTTCCGATGAGTAAACGAGCACGTTGGAGCAGTCTACAGCAGTCTACGCAGGAACAGCCACTGAACAGCCACTGGAACAACCATCTAGCTTCAGCATATCGGCCATTTTGGGGATTCTAGCCTGATTAGTACCTAAG

Full Affymetrix probeset data:

Annotations for 1628125_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720