FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628127_at:

>probe:Drosophila_2:1628127_at:722:665; Interrogation_Position=332; Antisense; TACAGGCACGCGAGGCATTCGACAA
>probe:Drosophila_2:1628127_at:101:681; Interrogation_Position=370; Antisense; TATGGCTACTACCAGCAGTTGGCTG
>probe:Drosophila_2:1628127_at:688:573; Interrogation_Position=390; Antisense; GGCTGTGAACAACGGCGATTGCATT
>probe:Drosophila_2:1628127_at:207:619; Interrogation_Position=409; Antisense; TGCATTAACGCCGAGGACCTGGGAC
>probe:Drosophila_2:1628127_at:627:285; Interrogation_Position=427; Antisense; CTGGGACTGGAGTACCTGGTTACCG
>probe:Drosophila_2:1628127_at:432:131; Interrogation_Position=440; Antisense; ACCTGGTTACCGAAGATCTGGGCAA
>probe:Drosophila_2:1628127_at:233:41; Interrogation_Position=455; Antisense; ATCTGGGCAACCTACTGGACGAGCA
>probe:Drosophila_2:1628127_at:89:351; Interrogation_Position=564; Antisense; GCAGATCTTTAGCAACCAGGAGCAT
>probe:Drosophila_2:1628127_at:98:437; Interrogation_Position=601; Antisense; GAGGATTCTGCCTCGAATTGTCAGC
>probe:Drosophila_2:1628127_at:244:223; Interrogation_Position=661; Antisense; AAGGAGCAGGTCTCCGAACGGCATT
>probe:Drosophila_2:1628127_at:128:383; Interrogation_Position=676; Antisense; GAACGGCATTACTCGATGGCTCAGA
>probe:Drosophila_2:1628127_at:49:49; Interrogation_Position=750; Antisense; ATGCCAACGGCGACGCTAGTCAAAA
>probe:Drosophila_2:1628127_at:153:649; Interrogation_Position=781; Antisense; TCAGGAGCTGGATTCTACAAACTAT
>probe:Drosophila_2:1628127_at:68:149; Interrogation_Position=858; Antisense; ACTTACGCGTATTTTCATTCCTTGA

Paste this into a BLAST search page for me
TACAGGCACGCGAGGCATTCGACAATATGGCTACTACCAGCAGTTGGCTGGGCTGTGAACAACGGCGATTGCATTTGCATTAACGCCGAGGACCTGGGACCTGGGACTGGAGTACCTGGTTACCGACCTGGTTACCGAAGATCTGGGCAAATCTGGGCAACCTACTGGACGAGCAGCAGATCTTTAGCAACCAGGAGCATGAGGATTCTGCCTCGAATTGTCAGCAAGGAGCAGGTCTCCGAACGGCATTGAACGGCATTACTCGATGGCTCAGAATGCCAACGGCGACGCTAGTCAAAATCAGGAGCTGGATTCTACAAACTATACTTACGCGTATTTTCATTCCTTGA

Full Affymetrix probeset data:

Annotations for 1628127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720