FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628128_at:

>probe:Drosophila_2:1628128_at:18:543; Interrogation_Position=116; Antisense; GGATTGCCTGGTTTGCCGAATGAAA
>probe:Drosophila_2:1628128_at:587:391; Interrogation_Position=137; Antisense; GAAAGGCCATATTCCCGAAGAACTT
>probe:Drosophila_2:1628128_at:298:105; Interrogation_Position=177; Antisense; AGACTCAGAAGATGTCCTCCAGGCC
>probe:Drosophila_2:1628128_at:48:677; Interrogation_Position=205; Antisense; TAGGAAACCATTGCAGTCTCTACAA
>probe:Drosophila_2:1628128_at:138:497; Interrogation_Position=220; Antisense; GTCTCTACAAACTGTCGGTCGGAAT
>probe:Drosophila_2:1628128_at:124:27; Interrogation_Position=243; Antisense; ATACGAGTTCCAGCCTGAAGCGCAT
>probe:Drosophila_2:1628128_at:428:123; Interrogation_Position=261; Antisense; AGCGCATAGGAAGTCCGATCTCCGA
>probe:Drosophila_2:1628128_at:51:211; Interrogation_Position=288; Antisense; AAGAATTTGGTGTCCTGGTGCAGCA
>probe:Drosophila_2:1628128_at:438:657; Interrogation_Position=319; Antisense; TAAGGCAGAGCAGCATCACACCGAT
>probe:Drosophila_2:1628128_at:81:559; Interrogation_Position=358; Antisense; GGACATAATCCTTATGCAGGCCCGT
>probe:Drosophila_2:1628128_at:210:35; Interrogation_Position=464; Antisense; ATCATGCTGGAGTCGCATCTGCAAA
>probe:Drosophila_2:1628128_at:94:401; Interrogation_Position=581; Antisense; GACATCCAAGTGAAGCCGCAATCTT
>probe:Drosophila_2:1628128_at:528:579; Interrogation_Position=607; Antisense; GGCCAACCAATTGCTGATCCAGTAT
>probe:Drosophila_2:1628128_at:210:449; Interrogation_Position=622; Antisense; GATCCAGTATCTTCACTCCAAGAAA

Paste this into a BLAST search page for me
GGATTGCCTGGTTTGCCGAATGAAAGAAAGGCCATATTCCCGAAGAACTTAGACTCAGAAGATGTCCTCCAGGCCTAGGAAACCATTGCAGTCTCTACAAGTCTCTACAAACTGTCGGTCGGAATATACGAGTTCCAGCCTGAAGCGCATAGCGCATAGGAAGTCCGATCTCCGAAAGAATTTGGTGTCCTGGTGCAGCATAAGGCAGAGCAGCATCACACCGATGGACATAATCCTTATGCAGGCCCGTATCATGCTGGAGTCGCATCTGCAAAGACATCCAAGTGAAGCCGCAATCTTGGCCAACCAATTGCTGATCCAGTATGATCCAGTATCTTCACTCCAAGAAA

Full Affymetrix probeset data:

Annotations for 1628128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720