FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628130_at:

>probe:Drosophila_2:1628130_at:570:325; Interrogation_Position=361; Antisense; GCGACAGACAACAGGCACACACTTA
>probe:Drosophila_2:1628130_at:14:29; Interrogation_Position=433; Antisense; ATACGGATGCGGACACAGGCCACGG
>probe:Drosophila_2:1628130_at:205:525; Interrogation_Position=456; Antisense; GGGCAACGCGTTAGGACTCTCCGGC
>probe:Drosophila_2:1628130_at:173:653; Interrogation_Position=528; Antisense; TCAATCGTTCAATCGCTCAATCGCT
>probe:Drosophila_2:1628130_at:292:45; Interrogation_Position=547; Antisense; ATCGCTCAGCCGCTGTGCAAAAAGG
>probe:Drosophila_2:1628130_at:357:503; Interrogation_Position=642; Antisense; GTCGCTGGAAGTCCTTTAGCTGCAG
>probe:Drosophila_2:1628130_at:263:265; Interrogation_Position=670; Antisense; CAGAGTCCTTTGCTGTAGCCGAGAA
>probe:Drosophila_2:1628130_at:50:311; Interrogation_Position=730; Antisense; CCACGACACATCCTTGTGCAGGAAT
>probe:Drosophila_2:1628130_at:376:565; Interrogation_Position=750; Antisense; GGAATTCGAAATCCGAGCGCTGCTT
>probe:Drosophila_2:1628130_at:539:49; Interrogation_Position=779; Antisense; ATGCGCTGCCGATTTGAAGGCTGGA
>probe:Drosophila_2:1628130_at:132:333; Interrogation_Position=798; Antisense; GCTGGAACATGTACCTAGGCGCACA
>probe:Drosophila_2:1628130_at:98:267; Interrogation_Position=821; Antisense; CATATATATGCCACGAGTCCTTGCC
>probe:Drosophila_2:1628130_at:186:259; Interrogation_Position=867; Antisense; CACGGAGCCTGGAAAGTGTTCGCTA
>probe:Drosophila_2:1628130_at:634:595; Interrogation_Position=904; Antisense; TGTGTGTCCTGCAGCTTTCAAGCTC

Paste this into a BLAST search page for me
GCGACAGACAACAGGCACACACTTAATACGGATGCGGACACAGGCCACGGGGGCAACGCGTTAGGACTCTCCGGCTCAATCGTTCAATCGCTCAATCGCTATCGCTCAGCCGCTGTGCAAAAAGGGTCGCTGGAAGTCCTTTAGCTGCAGCAGAGTCCTTTGCTGTAGCCGAGAACCACGACACATCCTTGTGCAGGAATGGAATTCGAAATCCGAGCGCTGCTTATGCGCTGCCGATTTGAAGGCTGGAGCTGGAACATGTACCTAGGCGCACACATATATATGCCACGAGTCCTTGCCCACGGAGCCTGGAAAGTGTTCGCTATGTGTGTCCTGCAGCTTTCAAGCTC

Full Affymetrix probeset data:

Annotations for 1628130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720