FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628131_at:

>probe:Drosophila_2:1628131_at:604:195; Interrogation_Position=2983; Antisense; AACTGGAGCGCCATGGTTTCAACTA
>probe:Drosophila_2:1628131_at:287:475; Interrogation_Position=2998; Antisense; GTTTCAACTACGTGGGCAAGGACTT
>probe:Drosophila_2:1628131_at:140:361; Interrogation_Position=3013; Antisense; GCAAGGACTTTTTCTACTCCGGCAT
>probe:Drosophila_2:1628131_at:646:141; Interrogation_Position=3050; Antisense; ACTGGAGGCCTACATCTACTCGGGA
>probe:Drosophila_2:1628131_at:642:77; Interrogation_Position=3109; Antisense; AGGATAAGATGCATGCCCGTGCCCG
>probe:Drosophila_2:1628131_at:411:195; Interrogation_Position=3211; Antisense; AACGGGATTGTCTCATTTCTTACGG
>probe:Drosophila_2:1628131_at:645:647; Interrogation_Position=3250; Antisense; TCATGGAGCGTCTGATGATCTCATC
>probe:Drosophila_2:1628131_at:184:605; Interrogation_Position=3265; Antisense; TGATCTCATCGGATGCCTTTGAGGT
>probe:Drosophila_2:1628131_at:65:69; Interrogation_Position=3315; Antisense; ATGGCCTACTGCTCCTGGTGTCATT
>probe:Drosophila_2:1628131_at:569:591; Interrogation_Position=3330; Antisense; TGGTGTCATTTCTGCCAGTCGTCGG
>probe:Drosophila_2:1628131_at:443:87; Interrogation_Position=3346; Antisense; AGTCGTCGGCCAATGTCTCTAAGAT
>probe:Drosophila_2:1628131_at:33:499; Interrogation_Position=3360; Antisense; GTCTCTAAGATATCCATGCCGTATG
>probe:Drosophila_2:1628131_at:99:625; Interrogation_Position=3376; Antisense; TGCCGTATGCATGCAAACTGCTCTT
>probe:Drosophila_2:1628131_at:201:281; Interrogation_Position=3396; Antisense; CTCTTCCAGGAGTTGACCAGCATGA

Paste this into a BLAST search page for me
AACTGGAGCGCCATGGTTTCAACTAGTTTCAACTACGTGGGCAAGGACTTGCAAGGACTTTTTCTACTCCGGCATACTGGAGGCCTACATCTACTCGGGAAGGATAAGATGCATGCCCGTGCCCGAACGGGATTGTCTCATTTCTTACGGTCATGGAGCGTCTGATGATCTCATCTGATCTCATCGGATGCCTTTGAGGTATGGCCTACTGCTCCTGGTGTCATTTGGTGTCATTTCTGCCAGTCGTCGGAGTCGTCGGCCAATGTCTCTAAGATGTCTCTAAGATATCCATGCCGTATGTGCCGTATGCATGCAAACTGCTCTTCTCTTCCAGGAGTTGACCAGCATGA

Full Affymetrix probeset data:

Annotations for 1628131_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720