Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628132_at:

>probe:Drosophila_2:1628132_at:385:595; Interrogation_Position=5411; Antisense; TGGGCGCCGTTCTCAGCGAGTGCAT
>probe:Drosophila_2:1628132_at:296:617; Interrogation_Position=5449; Antisense; TGCACCGTGCACAGTTTGTTTCTGA
>probe:Drosophila_2:1628132_at:631:89; Interrogation_Position=5461; Antisense; AGTTTGTTTCTGAGGTTCCTGCACT
>probe:Drosophila_2:1628132_at:340:149; Interrogation_Position=5483; Antisense; ACTTGGTGCCGGTGGACGTCATGTT
>probe:Drosophila_2:1628132_at:159:557; Interrogation_Position=5496; Antisense; GGACGTCATGTTCCTGCTGGAGCTT
>probe:Drosophila_2:1628132_at:143:419; Interrogation_Position=5515; Antisense; GAGCTTCTGCACGATTTGGGTTGTA
>probe:Drosophila_2:1628132_at:95:193; Interrogation_Position=5543; Antisense; AACTCATGGAGATGCGACCTCACAA
>probe:Drosophila_2:1628132_at:173:57; Interrogation_Position=5612; Antisense; ATGAGCAGCCAGTCACGGAGCTCTA
>probe:Drosophila_2:1628132_at:718:449; Interrogation_Position=5638; Antisense; GATCCCATGCAGACCTATGTTCAAG
>probe:Drosophila_2:1628132_at:525:53; Interrogation_Position=5672; Antisense; ATGCAATAGGCAGGCTCACCAACTT
>probe:Drosophila_2:1628132_at:45:463; Interrogation_Position=5734; Antisense; GATTCGGCAGAGGTTTTCCCTGTTA
>probe:Drosophila_2:1628132_at:646:307; Interrogation_Position=5812; Antisense; CCATTGATTTCGTTTTGTCTCTGAT
>probe:Drosophila_2:1628132_at:590:217; Interrogation_Position=5870; Antisense; AAGTCTTCAGTTCGTTTATCAATTA
>probe:Drosophila_2:1628132_at:652:699; Interrogation_Position=5897; Antisense; TTTTTATCCTGTCCAACCTATTCAT

Paste this into a BLAST search page for me
TGGGCGCCGTTCTCAGCGAGTGCATTGCACCGTGCACAGTTTGTTTCTGAAGTTTGTTTCTGAGGTTCCTGCACTACTTGGTGCCGGTGGACGTCATGTTGGACGTCATGTTCCTGCTGGAGCTTGAGCTTCTGCACGATTTGGGTTGTAAACTCATGGAGATGCGACCTCACAAATGAGCAGCCAGTCACGGAGCTCTAGATCCCATGCAGACCTATGTTCAAGATGCAATAGGCAGGCTCACCAACTTGATTCGGCAGAGGTTTTCCCTGTTACCATTGATTTCGTTTTGTCTCTGATAAGTCTTCAGTTCGTTTATCAATTATTTTTATCCTGTCCAACCTATTCAT

Full Affymetrix probeset data:

Annotations for 1628132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime