Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628133_at:

>probe:Drosophila_2:1628133_at:283:277; Interrogation_Position=1780; Antisense; CTTTGAATGCTCTCTGTGCGCCTAT
>probe:Drosophila_2:1628133_at:124:479; Interrogation_Position=1842; Antisense; GTTTGAAGGCCCTCCGCGATAGATC
>probe:Drosophila_2:1628133_at:313:457; Interrogation_Position=1859; Antisense; GATAGATCCCATAACCAGGCCCAGG
>probe:Drosophila_2:1628133_at:572:137; Interrogation_Position=1893; Antisense; ACGATGAGACCGGTAGGCGCAACTA
>probe:Drosophila_2:1628133_at:59:493; Interrogation_Position=1952; Antisense; GTAAGCGCCGAACAATTGGCCGATT
>probe:Drosophila_2:1628133_at:269:395; Interrogation_Position=1997; Antisense; GAAATGATTGTGATGCCGCCGGAGA
>probe:Drosophila_2:1628133_at:568:317; Interrogation_Position=2014; Antisense; GCCGGAGAAGCTAGACGACCATCAT
>probe:Drosophila_2:1628133_at:632:519; Interrogation_Position=2069; Antisense; GTGGATAGTGCTCATTCGACCTCGG
>probe:Drosophila_2:1628133_at:238:635; Interrogation_Position=2084; Antisense; TCGACCTCGGCACTGGATTTACGAA
>probe:Drosophila_2:1628133_at:71:391; Interrogation_Position=2106; Antisense; GAAAGCCCAGGGATGACCAGACGGA
>probe:Drosophila_2:1628133_at:344:265; Interrogation_Position=2123; Antisense; CAGACGGAGGACTTGGCAGGCAACA
>probe:Drosophila_2:1628133_at:274:435; Interrogation_Position=2165; Antisense; GAGGGAGCCAAGACGGAGCCAAATT
>probe:Drosophila_2:1628133_at:480:413; Interrogation_Position=2180; Antisense; GAGCCAAATTTAGAACCCTTGTCAT
>probe:Drosophila_2:1628133_at:210:89; Interrogation_Position=2227; Antisense; AGTCATGCCAAAGCCCAAAGGGTCG

Paste this into a BLAST search page for me
CTTTGAATGCTCTCTGTGCGCCTATGTTTGAAGGCCCTCCGCGATAGATCGATAGATCCCATAACCAGGCCCAGGACGATGAGACCGGTAGGCGCAACTAGTAAGCGCCGAACAATTGGCCGATTGAAATGATTGTGATGCCGCCGGAGAGCCGGAGAAGCTAGACGACCATCATGTGGATAGTGCTCATTCGACCTCGGTCGACCTCGGCACTGGATTTACGAAGAAAGCCCAGGGATGACCAGACGGACAGACGGAGGACTTGGCAGGCAACAGAGGGAGCCAAGACGGAGCCAAATTGAGCCAAATTTAGAACCCTTGTCATAGTCATGCCAAAGCCCAAAGGGTCG

Full Affymetrix probeset data:

Annotations for 1628133_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime