FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628136_at:

>probe:Drosophila_2:1628136_at:99:101; Interrogation_Position=1352; Antisense; AGAGGATGGCCAAGTCACCGCTGCA
>probe:Drosophila_2:1628136_at:673:585; Interrogation_Position=1427; Antisense; TGGACCTGCATCGTGATCCATTCAA
>probe:Drosophila_2:1628136_at:573:573; Interrogation_Position=1487; Antisense; GGCGGTTTCTTAACTTGCAGCAACT
>probe:Drosophila_2:1628136_at:644:23; Interrogation_Position=1546; Antisense; ATATGCGAAGGACCGTTCTACCACG
>probe:Drosophila_2:1628136_at:533:49; Interrogation_Position=1597; Antisense; ATGCGCTCCGTGATGACCGAATACA
>probe:Drosophila_2:1628136_at:537:365; Interrogation_Position=1615; Antisense; GAATACATCATGATCGCCCAGCAGG
>probe:Drosophila_2:1628136_at:194:347; Interrogation_Position=1635; Antisense; GCAGGCGGGCCTAATGAACCATTGG
>probe:Drosophila_2:1628136_at:381:407; Interrogation_Position=1668; Antisense; GACGTTCTGGGAGGCAGTGCATCTC
>probe:Drosophila_2:1628136_at:86:347; Interrogation_Position=1697; Antisense; GCATCCATGTGCACTTATTTGACGA
>probe:Drosophila_2:1628136_at:407:585; Interrogation_Position=1771; Antisense; TGGACTTTGGGTCTGATCCTAGCCG
>probe:Drosophila_2:1628136_at:653:639; Interrogation_Position=1797; Antisense; TCTGGCTTTTGCTGCCGAAATGAAG
>probe:Drosophila_2:1628136_at:321:83; Interrogation_Position=1820; Antisense; AGTGGCACGAGCATGTGACCTTCAA
>probe:Drosophila_2:1628136_at:286:409; Interrogation_Position=1836; Antisense; GACCTTCAAACGTCGTCCTGTTATA
>probe:Drosophila_2:1628136_at:712:97; Interrogation_Position=1879; Antisense; AGATCGTTTCTCAGGCGCTTCATGA

Paste this into a BLAST search page for me
AGAGGATGGCCAAGTCACCGCTGCATGGACCTGCATCGTGATCCATTCAAGGCGGTTTCTTAACTTGCAGCAACTATATGCGAAGGACCGTTCTACCACGATGCGCTCCGTGATGACCGAATACAGAATACATCATGATCGCCCAGCAGGGCAGGCGGGCCTAATGAACCATTGGGACGTTCTGGGAGGCAGTGCATCTCGCATCCATGTGCACTTATTTGACGATGGACTTTGGGTCTGATCCTAGCCGTCTGGCTTTTGCTGCCGAAATGAAGAGTGGCACGAGCATGTGACCTTCAAGACCTTCAAACGTCGTCCTGTTATAAGATCGTTTCTCAGGCGCTTCATGA

Full Affymetrix probeset data:

Annotations for 1628136_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720