Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628138_s_at:

>probe:Drosophila_2:1628138_s_at:491:471; Interrogation_Position=286; Antisense; GTTCGCCGCTCTCAGGAGCCTGAAA
>probe:Drosophila_2:1628138_s_at:372:385; Interrogation_Position=342; Antisense; GAACTATCGCGATGCTAATGCGACA
>probe:Drosophila_2:1628138_s_at:675:233; Interrogation_Position=358; Antisense; AATGCGACACGCTTGCTGAATGTGG
>probe:Drosophila_2:1628138_s_at:325:615; Interrogation_Position=374; Antisense; TGAATGTGGCGCTCACCCATCGTCA
>probe:Drosophila_2:1628138_s_at:187:651; Interrogation_Position=386; Antisense; TCACCCATCGTCAACGTTTGCATTT
>probe:Drosophila_2:1628138_s_at:199:197; Interrogation_Position=398; Antisense; AACGTTTGCATTTGGATCCGGATGA
>probe:Drosophila_2:1628138_s_at:519:427; Interrogation_Position=421; Antisense; GAGATAGAGTTCGTGCTAAGCAGCT
>probe:Drosophila_2:1628138_s_at:229:291; Interrogation_Position=432; Antisense; CGTGCTAAGCAGCTATTGGAGGCAA
>probe:Drosophila_2:1628138_s_at:202:727; Interrogation_Position=447; Antisense; TTGGAGGCAATTGAATACAGACATT
>probe:Drosophila_2:1628138_s_at:272:473; Interrogation_Position=494; Antisense; GTTCAGCACTGGATTGTCTGGAGCC
>probe:Drosophila_2:1628138_s_at:36:541; Interrogation_Position=504; Antisense; GGATTGTCTGGAGCCGGCCATTAAG
>probe:Drosophila_2:1628138_s_at:50:481; Interrogation_Position=650; Antisense; GTTTGGCGGACTTGGGTCTGAAACT
>probe:Drosophila_2:1628138_s_at:601:619; Interrogation_Position=738; Antisense; TGCTTATCTTCACCATTCGCCAAAT
>probe:Drosophila_2:1628138_s_at:46:395; Interrogation_Position=773; Antisense; GAAAGGCCCACGACGCTGTTCGAAA

Paste this into a BLAST search page for me
GTTCGCCGCTCTCAGGAGCCTGAAAGAACTATCGCGATGCTAATGCGACAAATGCGACACGCTTGCTGAATGTGGTGAATGTGGCGCTCACCCATCGTCATCACCCATCGTCAACGTTTGCATTTAACGTTTGCATTTGGATCCGGATGAGAGATAGAGTTCGTGCTAAGCAGCTCGTGCTAAGCAGCTATTGGAGGCAATTGGAGGCAATTGAATACAGACATTGTTCAGCACTGGATTGTCTGGAGCCGGATTGTCTGGAGCCGGCCATTAAGGTTTGGCGGACTTGGGTCTGAAACTTGCTTATCTTCACCATTCGCCAAATGAAAGGCCCACGACGCTGTTCGAAA

Full Affymetrix probeset data:

Annotations for 1628138_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime