Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628139_at:

>probe:Drosophila_2:1628139_at:514:721; Interrogation_Position=1166; Antisense; TTCCAGTGCCTGACTCATGAAGATT
>probe:Drosophila_2:1628139_at:581:531; Interrogation_Position=1218; Antisense; GGGTGAGGCCTCCAAATTCATATGT
>probe:Drosophila_2:1628139_at:572:713; Interrogation_Position=1234; Antisense; TTCATATGTTTCTTCCTGGGACTAC
>probe:Drosophila_2:1628139_at:111:85; Interrogation_Position=1259; Antisense; AGTGTGCACTCGCTAATCCATTTGG
>probe:Drosophila_2:1628139_at:50:243; Interrogation_Position=1289; Antisense; AATAGTCGTGACATTCGGCAGCGCA
>probe:Drosophila_2:1628139_at:423:567; Interrogation_Position=1305; Antisense; GGCAGCGCATAAAGCACTCTTCGGA
>probe:Drosophila_2:1628139_at:252:145; Interrogation_Position=1320; Antisense; ACTCTTCGGAACTGGCAAACTTGCT
>probe:Drosophila_2:1628139_at:435:177; Interrogation_Position=1336; Antisense; AAACTTGCTAGACGGCTTGCGGAGA
>probe:Drosophila_2:1628139_at:279:383; Interrogation_Position=1359; Antisense; GAACGTGTCCAATGCCACTGGTTAA
>probe:Drosophila_2:1628139_at:289:679; Interrogation_Position=1399; Antisense; TAGGCTGTGGAACCGCAATCAATCA
>probe:Drosophila_2:1628139_at:475:265; Interrogation_Position=1475; Antisense; CAGAGGGTGCATTTCCTTAGGTCGA
>probe:Drosophila_2:1628139_at:195:81; Interrogation_Position=1499; Antisense; AGGGTCGCCCACGAAGACTGTAGTT
>probe:Drosophila_2:1628139_at:604:343; Interrogation_Position=1545; Antisense; GCATTCTCCGTTCAAAGCCATTTAT
>probe:Drosophila_2:1628139_at:170:513; Interrogation_Position=1631; Antisense; GTGATCGAGAGCACCGTCCAGATAT

Paste this into a BLAST search page for me
TTCCAGTGCCTGACTCATGAAGATTGGGTGAGGCCTCCAAATTCATATGTTTCATATGTTTCTTCCTGGGACTACAGTGTGCACTCGCTAATCCATTTGGAATAGTCGTGACATTCGGCAGCGCAGGCAGCGCATAAAGCACTCTTCGGAACTCTTCGGAACTGGCAAACTTGCTAAACTTGCTAGACGGCTTGCGGAGAGAACGTGTCCAATGCCACTGGTTAATAGGCTGTGGAACCGCAATCAATCACAGAGGGTGCATTTCCTTAGGTCGAAGGGTCGCCCACGAAGACTGTAGTTGCATTCTCCGTTCAAAGCCATTTATGTGATCGAGAGCACCGTCCAGATAT

Full Affymetrix probeset data:

Annotations for 1628139_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime